Translate this page into:
Actin-related protein 6 regulates the Hedgehog signaling pathway: Molecular basis for stemness maintenance of hepatoma cells
*Corresponding author: Xiaoqing Xu, Department of Radiation Oncology and Medical Administration, Shandong Cancer Hospital and Institute, Shandong First Medical University and Shandong Academy of Medical Sciences, Jinan, China. cxgsdcn@163.com
-
Received: ,
Accepted: ,
How to cite this article: Jiao C, Zhu L, Zhu A, Xu X. Actin-related protein 6 regulates the Hedgehog signaling pathway: Molecular basis for stemness maintenance of hepatoma cells. CytoJournal. 2026;23:9. doi: 10.25259/Cytojournal_62_2025
Abstract
Objective:
The liver is a common primary cancer site in humans. Actin-related protein 6 (ACTR6) plays a key role in liver cancer. The aim of this study was to further explore the regulatory molecular mechanism of ACTR6 in liver cancer.
Material and Methods:
In this study, hepatoma cell HuH-7 was evaluated by 5-ethynyl-2’-deoxyuridine staining, colony formation, Transwell assay, and wound healing assay. The possible mechanism of the action of ACTR6 on hepatocellular carcinoma cells was evaluated by analyzing sphere formation, the key factors of the Hedgehog (Hh) signaling pathway, and molecules related to cell stemness. Then, xenografted mouse tumor models were used to demonstrate the promotion effect of ACTR6 on liver cancer in vivo.
Results:
ACTR6 was highly expressed in HuH-7h and HepG2 cells (P < 0.001). Silencing ACTR6 inhibited the migration, invasion capacity, and activity of HuH-7 (P < 0.01). ACTR6 activated the Hh signaling pathway by upregulating the expression of Sonic Hedgehog, patched 1, smoothened, and glioma-associated transcription factor 1. In addition, ACTR6 increased the molecular level of cell stemness by increasing the level of cellular myelocytomatosis oncogene, octamer-binding transcription factor 4, Nanog homeobox, and SRY-box transcription factor 2. Vismodegib reversed the promoting effect of ACTR6 on the Hh signaling pathway and stem-related proteins in cells.
Conclusion:
ACTR6 regulates the molecular basis of stemness maintenance of liver cancer cells through the Hh signaling pathway and promotes the occurrence of liver cancer. This study provides possible targets for the clinical treatment of liver cancer.
Keywords
Actin-related protein 6
Hedgehog signaling pathway
Liver cancer
Stemness
INTRODUCTION
The fourth most common cause of cancer-related mortality globally and the sixth most common type of cancer overall is liver cancer.[1,2] Hepatocellular carcinoma (HCC) may be responsible for as much as 90% of instances.[3] Effective measures, including imaging, improved blood tests, and hepatitis immunization, have substantially decreased the prevalence of HCC worldwide, particularly in China. Revealing the systemic and molecular mechanisms of liver cancer can help in the development of effective therapies to extend the 5-year survival of patients.[4]
Liver cancer stem cells (LCSCs) are part of tumor cells that have strong tumor potential, high self-renewal ability, and unlimited differentiation ability.[5] According to reports, LCSCs are resistant to chemotherapy and traditional radiotherapy. The process through which LCSCs maintain stemness is intricate and still unclear. The supporting tumor microenvironment is necessary for the stemness of LCSCs, indicating a dynamic interaction between LCSCs and other elements of the tumor microenvironment.[6-8] Furthermore, stemness preservation of LCSCs may be facilitated by the differentiation plasticity of tumor cells.[9]
Under some circumstances, either classical or non-classical pathways can stimulate the transduction of the Hedgehog (Hh) signal. Classical Hh pathways include secretory ligands (Sonic, Indian, and Desert), patched 1 (Ptch1), smoothened (SMO), and transcription factor Gli proteins (glioma-associated transcription factor [Gli]1, Gli2, and Gli3).[10,11] When the ligand is not present, Ptch1 prevents SMO from acting, which renders the Gli protein inactive.[12] However, in adult liver, Hh signaling is typically quiet. Injured hepatocytes express Hh ligands, and tissue restoration involves increased Hh signaling.
Thus far, little has been reported about actin-related protein 6 (ACTR6). ACTR6 has been found to be a novel biomarker in lung cancer that could serve as a prognostic marker for patient survival.[13] In this study, we further investigated the possible mechanism of action of ACTR6 in HCC. We investigated the possible mechanism through which ACTR6 promotes HCC by determining the key factors in the Hh signaling pathway and associated proteins in dry maintenance.
MATERIAL AND METHODS
Cell culture and transfection
Liver cancer cell HepG2 (BFN60805958), HuH-7 cells (BFN60807349), and normal liver cell L-O2 (BFN608006124) were maintained in a high-glucose Dulbecco Modified Eagle Medium (11965126, Gibco, Life Technologies, Rockville, MD, the USA) supplemented with 10% fetal bovine serum (FBS, S9020, Solarbio, Beijing, China) and 1% penicillin/streptomycin solution (P7630, Solarbio, Beijing, China). The cells were purchased from the American Type Culture Collection (Manassas, VA, the USA). Short tandem repeat analysis showed that all the cells were derived from their parent cells and tested negative for mycoplasma.
The cells were transfected with ACTR6 short hairpin (shRNA) and ACTR6 overexpression plasmid using Lipofectamine 2000 (11668019, Thermo Fisher Scientific, Waltham, MA, the USA). The cells were divided into a control group, negative control to ACTR6 shRNA (sh-NC), ACTR6 shRNA (sh-ACTR6), negative control to ACTR6 overexpression plasmid (OE-NC), ACTR6 overexpression plasmid (OE-ACTR6), and OE-MYBL2 + 20 μm Vismodegib (HY-10440, MedChemExpress, Monmouth Country, NJ, the USA). When the cell density changed to 40%–50%, 10 μg/mL polybrene (H8761, Solarbio, Beijing, China) was added for lentiviral transfection, and the medium was replaced with a fresh one 24 h later. The transfection efficiency was observed by fluorescence microscopy (Olympus, Tokyo, Japan).
Sphere formation assay
The cells were cultured at a density of 1,000 cells per mL in serum-free RPMI-1640 medium (R8758, Merk, Darmstadt, Germany) using six-well plates with ultra-low adsorption (3471, Corning Incorporated, Corning, NY, the USA). B27 (60703ES03, Yeasen, Shanghai, China), 20 ng/mL epidermal growth factor (SRP3027, Merk, Darmstadt, Germany), and 20 ng/mL fibroblast growth factor (GF003, Merk, Darmstadt, Germany) were added to the culture medium. After 10 days, microspheres larger than 75 μm in diameter were counted. The microspheres were collected. Some of them were used in subsequent experiments, and the rest were enzymatically decomposed into individual cells and counted. Then, 1,000 cells were selected and cultured under the abovementioned conditions. The process was repeated 3 times, with the resulting microspheres labeled as 1st, 2nd, and 3rd.
Cell counting kit-8 (CCK-8) assay
A 96-well plate was inoculated at a density of 4,000 cells/well. Exactly 10 μL CCK-8 (C0038, Beyotime Biotechnology, Shanghai, China) solution was added to each well. Cell viability was calculated using the absorbance value at 450 nm through an enzyme-labeled instrument (A96, Mettler Toledo, Zurich, Switzerland).
5-ethyl-2’-deoxyuracil (EdU) staining
The cells were inoculated on 24-well plates with a density of 4 × 104 cells/well, and each well was added with 100 μL EdU solution (C00054, RIBOBIO, Guangzhou, China) and incubated at 37°C solution (C00054, RIBOBIO, Guangzhou, Chinath 4’,6-diamino-2’-phenylindole, C0065, Solarbio, Beijing, China). Then, the positive cells were observed by fluorescence microscopy (CX41-32RFL, Olympus Corporation, Tokyo, Japan).
Wound healing assay
The cells were inoculated in 6-well plates and fixed at 4℃ with 4% paraformaldehyde (P1110, Solarbio, Beijing, China) for 30min. After fixation, the cells were washed 2 times with phosphate-buffered saline (BL2215A, Biosharp, China, Hubei) for 3 min each time and stained with 1% crystal violet solution (BL2248A, Biosharp, China, Hubei) for 30 min.
Transwell assay
In the Transwell insertion chamber, 1 × 105 cells were inoculated. In the invasion experiment, Matrigel (354234, Corning Costar, Cambridge, MA, the USA) was applied to the upper cavity. The lower chamber was filled with 800 μL of media containing 10% FBS, which was then incubated for 48 h at 37°C. The upper cavity was removed after incubation, and the interior of the film was carefully swabbed and then cleaned 2 times. The cells were cleaned, air-dried upside down, and stained with crystal violet (C8470, Solarbio, Beijing, China).
Colony formation
A sterile petri dish was prepared and inoculated with 1 × 103 cells. The colony was fixed, dyed with 0.5% crystal violet, rinsed with water, and air-dried. The cell colonies were counted.
Xenograft tumor
Eighteen SPF BALB/c nude mice (18–22 g, 6 weeks) were employed. The mice were maintained at 25.0±2.0°C and 55.0±5.0% relative humidity with a 12h light/dark cycle and had ad libitum access to food and water. Then, 1 × 107 HuH-7 cells were injected from the back of mice to the right side to form subcutaneous xenograft tumors. The mice were randomly divided into three groups: NC, ACTR6, and ACTR6 + vismodegib. The NC group was injected with HuH-7 cells, the ACTR6 group was injected with cells transfected with ACTR6 shRNA, and the ACTR6 + vismodegib group was injected with cells transfected with ACTR6 shRNA + 200 mg/ kg/d vismodegib orally. After 18 days, all mice were euthanized by intraperitoneal injection of excess 1% pentobarbital sodium (200 mg/kg). Tumor tissue was collected and frozen at −80℃.
Immunohistochemical staining
The tumor tissues were dried, embedded, sliced, and fixed with 4% paraformaldehyde for an entire night at room temperature. The tissue was sliced into 5 μm and treated with primary antibody (Thermo Fisher Scientific, Waltham, MA, the USA). The DAB secondary antibody test was positive, and a BX46 microscope (Olympus Corporation, Tokyo, Japan) was used for analysis. The primary antibodies were as follows: Sonic Hedgehog (Shh) (1:500, MA5-41159), Ptch1 (1:500, PA5-87508), SMO (1:500, PA5-76145), and Gli1 (1:500, MA5-32553).
Quantitative reverse transcription polymerase chain reaction (RT-PCR)
Total RNA was extracted by TRIzol reagent (R0016, Beyotime Biotechnology, Shanghai, China). Reverse transcription (RT) and polymerase chain reaction (PCR) were performed using the PrimeScript™ One-Step RT-PCR Kit (RR055A, TaKaRa Bio Inc., Kafu City, Yamanashi Prefecture, Japan). The relative expression of genes was calculated using 2−ΔΔCt. β-actin served as an endogenous reference. The primer sequences are shown in Table 1.
| Forward (5’-3’) | Reverse (5’-3’) | |
|---|---|---|
| ACTR6 | ATGACGACCTTAGTGCTGGAT | TGACCGGAACTGACAATTAGGAA |
| CMYC | CCCCTACCCTCTCAACGACA | CTTCTTGTTCCTCCTCAGAGTCG |
| OCT4 | TCAGGAGATATGCAAAGCAGAA | TTGCCTCTCACTCGGTTCTC |
| NANOG | AGATGCCTCACACGGAGACT | GTTTGCCTTTGGGACTGGTG |
| SOX2 | ACATGAACGGCTGGAGCAA | GTAGGACATGCTGTAGGTGGG |
| β-actin | TCTGGCAACGGTGAAGGTGACA | CACCTCCCCTGTGTGGACTT |
ACTR6: Actin-related protein 6, CMYC: Cellular myelocytomatosis oncogene, OCT4: Octamer-binding transcription factor 4, NANOG: Nanog homeobox, SOX2: SRY-box transcription factor 2, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
Western blot
Total protein was extracted by radioimmunoprecipitation assay (R0010, Solarbio, Beijing, China), and its concentration was determined using the bicinchoninic acid assay kit (PC0020, Solarbio, Beijing, China). The proteins were separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane (IPVH00010, Millipore Corporation, Billerica, MA, the USA). The primary antibody (1:1000, Thermo Fisher Scientific, Waltham, MA, the USA) was incubated at 4℃ overnight, and the second antibody (1:10000, 31460, Thermo Fisher Scientific, Waltham, MA, the USA) was incubated at room temperature for 2 h. Tris-buffered saline with Tween-20 was then utilized to wash the membrane (T1087, Solarbio, Beijing, China). Image Quant LAS4000 (GE Healthcare, Chicago, IL, the USA) and enhanced chemiluminescence (BL520b, Biosharp, Hefei, Anhui, China) were used to view the protein bands. Image J (v1.3.4, National Institutes of Health, Bethesda, MD, the USA) was adopted to assess the bands’ gray values. The primary antibodies were as follows: ACTR6 (A305-230A), cellular myelocytomatosis oncogene (CMYC) (MA1-980), octamer-binding transcription factor 4 (OCT4) (MA1-104), Nanog homeobox (NANOG) (PA1-097), SRY-box transcription factor 2 (SOX2) (14-9811-28), Shh (MA5-41159), Ptch1 (PA5-87508), SMO (PA5-76145), and Gli1 (MA5-32553).
Statistical analysis
The experimental data were analyzed and processed using GraphPad Prism 8.0 software (GraphPad Software, Inc., San Diego, CA, USA). One-way Analysis of variance and Turkey multiple range tests were performed to detect differences between groups. Comparison between the two groups was performed through a t-test, and P < 0.05 was considered statistically significant.
RESULTS
Expression of ACTR6 in HCC cells
As shown in Figure 1a-c, we determined ACTR6 messenger RNA (mRNA) and protein levels in L-O2, HuH-7, and HepG2 cells, and the results showed that ACTR6 was highly expressed in HuH-7 and HepG2 cells (P < 0.001). Subsequently, a proliferation model of HCCs in vitro was established through a tumor microsphere formation experiment. Figure 1d shows that ACTR6 expression increased significantly in the stemness of liver cancer cells (P < 0.001). Therefore, the expression of ACTR6 in the HuH-7 cells was silenced to further explore the effect of ACTR6 knockdown on HuH-7 cells. The knockdown efficiency of ACTR6 in HuH-7 cells was validated through quantitative RT-PCR and Western blot experiments (P < 0.001), as shown in Figure 1e-g.
- ACTR6 is highly expressed in liver cancer cells. (a-c) mRNA and protein levels of ACTR6 in L-O2, HuH-7, and HepG2 cells. (d) mRNA levels of ACTR6 in spheres. (e-g) ACTR6 mRNA and protein expression in HuH-7 cells after ACTR6 silencing. n = 3. ✶✶✶P < 0.001. ACTR6: Actin-related protein 6, sh-NC: negative control to ACTR6 shRNA, sh-ACTR6: ACTR6 shRNA, mRNA: Messenger RNA, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.
ACTR6 promotes liver cancer cell migration
As indicated in Figure 2a-d, the proliferation capacity of the HuH-7 cells decreased after silencing ACTR6 (P < 0.001). Figure 2e-g shows that the migration and invasion ability of the HuH-7 cells decreased significantly after silencing ACTR6 (P < 0.01). The activity of the HuH-7 cells was measured with the CCK-8 kit, and the results revealed that the activity decreased significantly after silencing ACTR6 (P < 0.001), [Figure 2h]. Figures 2i and j show that after silencing ACTR6, HuH-7 cell migration was inhibited (P < 0.001).
- ACTR6 promotes liver cancer cell migration. (a and b) EdU assay was performed to assess the proliferation capacity of HuH-7 cells that silence ACTR6. Scale bar = 50 μm. (c and d) Clonal formation analysis of HuH-7 cells that silence ACTR6. (e-g) Transwell analysis of HuH-7 cells that silence ACTR6. Scale bar = 50 μm. (h) CCK-8 was used to assay the activity of HuH-7 cells that silence ACTR6. (i and j) Wound-healing analysis silenced ACTR6 HuH-7 cells. Scale bar = 100 μm. n = 3. ✶✶P < 0.01, ✶✶✶P < 0.001. EdU: 5-ethyl-2’-deoxyuracil, DAPI: 4’,6-diamino-2’-phenylindole, ACTR6: Actin-related protein 6, CCK-8: Cell counting kit-8,
ACTR6 maintains the stemness of liver cancer cells
The effect of ACTR6 on the maintenance of cell stemness was analyzed using sphere formation assay and cell stem-related indicators. Figures 3a and b show that inhibition of ACTR6 expression reduced the formation of HuH-7 cell microspheres (P < 0.01). To further investigate the relationship between ACTR6 expression and HuH-7 cell stemness, we used an amplification model to collect HuH-7 cells at 12 h and on days 2, 4, 6, and 10 [Figure 3c]. The expression of ACTR6 in spherical HuH-7 cells gradually increased with time (P < 0.001). These results indicate that ACTR6 is highly expressed in HuH-7 and is involved in maintaining the stemness of HCCs. The mRNA and protein expression levels of CMYC, OCT4, NANOG, and SOX2 were also determined. Figure 3d-l shows that silencing ACTR6 inhibited the expression of these stemness maintenance molecules (P < 0.05).
- ACTR6 increases the level of cell stemness markers. (a) Representative image of the HuH-7 sphere of silent ACTR6. Scale bar = 10 μm. (b) Number of spheres formed from HuH-7 cells. (c) Expression of ACTR6 in HuH-7 cells analyzed by qRT-PCR 1, 2, 4, 6, and 10 days after spheroid formation. (d-g) mRNA levels of CMYC, OCT4, NANOG, and SOX2 after silencing ACTR6. (h-l) Protein levels of CMYC, OCT4, NANOG, and SOX2 after silencing ACTR6. n = 3. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. CMYC: Cellular myelocytomatosis oncogene, OCT4: Octamer-binding transcription factor 4, NANOG: Nanog homeobox, SOX2: SRY-box transcription factor 2, ACTR6: Actin-related protein 6, mRNA: Messenger RNA.
ACTR6 regulates the Hh signaling pathway
As shown in Figure 4a-e, the association between the ACTR6 and Hh signals was analyzed. The results revealed that the protein levels of Shh, Ptch1, SMO, and Gli1 decreased significantly in the ACTR6 knockdown cell lines (P < 0.001), indicating that the Hh signaling pathway was markedly inhibited after ACTR6 suppression.
- ACTR6 activates the Hh signaling pathway. (a-e) Protein levels of Shh, Ptch1, SMO, and Gli1 after silencing ACTR6. n = 3. ✶✶P < 0.01, ✶✶✶P < 0.001. Shh: Sonic Hedgehog, Ptch1: patched 1, SMO: Smoothened, Gli1: Glis family zinc finger, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, ACTR6: Actin-related protein 6, Hh: Hedgehog.
Vismodegib inhibits the cancer-promoting effects of ACTR6
To further demonstrate the connection between ACTR6 and the Hh signaling pathway, this study expressed ACTR6 in parallel with vismodegib. As indicated in Figures 5a and b, western blot was used to verify the successful overexpression of ACTR6 (P < 0.001). Figure 5c-f shows that ACTR6 promoted the proliferation of HuH-7 cells, and vismodegib treatment reversed the promoting effect of ACTR6 (P < 0.01). Figure 5g-k indicates that vismodegib reversed the promoting effect of ACTR6 on the cellular stemness molecules. The expression of SMO and Gli1 decreased significantly in the downstream area (P < 0.01). These results suggest that ACTR6 regulates the occurrence of liver cancer through the Hh signaling pathway.
- Vismodegib suppresses ACTR6-mediated activation of the Hh signaling pathway in hepatocellular carcinoma cells. (a and b) Western blot verified the overexpression efficiency of ACTR6. (c-f) Vismodegib inhibited ACTR6 from promoting the proliferation of HuH-7 cells. Scale bar = 50 μm. (g-k) Vismodegib inhibited ACTR6 activation of Hh signal transduction in HuH-7 cells. n = 3. ns: No statistical significance; ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. OE-NC: Negative control to ACTR6 overexpression plasmid, OE-ACTR6: ACTR6 overexpression plasmid. ACTR6: Actin-related protein 6, Hh: Hedgehog.
Vismodegib blocks ACTR6-mediated upregulation of stemness markers in HCC cells
The relationship between the Hh signal and cellular stem molecules was also discussed. Figure 6a-e shows that ACTR6 promoted the expression of cellular dry molecules, and the promoting effect of ACTR6 was reversed after vismodegib treatment (P < 0.05). The same result is demonstrated in Figure 6f and g. Hence, vismodegib inhibited the promotion of HuH-7 cell spheres by ACTR6 (P < 0.01).
- Vismodegib reverses the stemness maintenance effect of ACTR6 on liver cancer cells. (a-e) Protein levels of CMYC, OCT4, NANOG, and SOX2 in HuH-7 cells after Vismodegib treatment. (f) Representative image of the HuH-7 sphere treated by Vismodegib. Scale bar = 10 μm. (g) Number of spheres formed from HuH-7 cells treated by Vismodegib. n = 3. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. CMYC: Cellular myelocytomatosis oncogene, OCT4: Octamer-binding transcription factor 4, NANOG: Nanog homeobox, SOX2: SRY-box transcription factor 2, ACTR6: Actin-related protein 6.
Effects of ACTR6 combined with Vismodegib on HCCs in vivo
The effect of ACTR6 on liver cancer was further investigated using a xenotransplantation tumor model of mice. Figure 7a-c reveals that ACTR6 significantly promoted tumor growth, whereas vismodegib significantly inhibited the promoting effect of ACTR6 (P < 0.05). Immunohistochemical staining of tumor tissues showed that the Hh signal transduction results were similar to those in vivo [ Figure 7d-h]. The expression of SMO and Gli1 was significantly inhibited by vismodegib in the tumors [Figure 7i-m]. No statistically significant difference was observed in the expression of Shh and Ptch1. In addition, vismodegib inhibited Hh signal transduction in the tumor tissues (P < 0.05).
- Vismodegib reverses the tumor-promoting effects of ACTR6 in vivo. (a) HuH-7 cell xenograft tumor. (b and c) Tumor volume and weight. (d-h) Immunohistochemical staining of Shh, Ptch1, SMO, and Gli1 in tumor tissues. Scale bar = 20 μm. (i-m) Protein expression of CMYC, OCT4, NANOG, and SOX2 in tumor tissues. n = 3. ns: No statistical significance; ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. ACTR6: Actin-related protein 6. CMYC: Cellular myelocytomatosis oncogene, OCT4: Octamer-binding transcription factor 4, NANOG: Nanog homeobox, SOX2: SRY-box transcription factor 2, ACTR6: Actin-related protein 6, Shh: Sonic Hedgehog, Ptch1; Patched 1, SMO: Smoothened, Gli1: Glioma-associated transcription factor.
DISCUSSION
Actin-related proteins (ARPs) are required for the function of the chromatin remodeling complex.[14] Prior research has demonstrated the presence of ARP4–ARP9 in complexes involved in histone modification and chromatin remodeling.[15] In this study, we further explored the possible mechanism by which ACTR6 promotes HCC. Our results revealed that ACTR6 was highly expressed in HuH-7 cells. In addition, ACTR6 promoted the migration and proliferation of HuH-7 cells. Relevant studies have shown that TAP1 is one of the target genes of the Hh signaling pathway in HCC cell lines. Therefore, subsequent studies may explore the connection between ACTR6 and TAP1.[16]
Numerous forms of adult liver injury involve the reactivation of Hh, a morphogenetic signaling system that regulates progenitor cell fate and tissue formation during embryogenesis.[17] We found that the Hh signaling pathway was activated in the HuH-7 liver cancer cells, and Hu signaling was inhibited after ACTR6 silencing. Studies on liver cancer have found that in HCC cell lines with detectable endogenous Hh signaling (Hep3B, HuH-7, and PLC/PRF/5), Hh signaling is inhibited (using Shh neutralizing antibodies), Hh target gene expression is reduced, and apoptosis is induced.[18] Similarly, we found that after treatment with an SMO inhibitor (Vismodegib), the cancer-promoting effects of ACTR6 were inhibited, and the migration ability of HuH-7 cells decreased. This result was confirmed in vivo. Many studies have found that in breast cancer, the Hh signaling pathway regulates cell stemness, and overexpression of Gli1 leads to tumor growth in mice.[19] We obtained similar findings. To further demonstrate that the Hh signaling pathway regulates HuH-7 cell stemness in liver cancer, we used vismodegib to investigate. Vismodegib reversed the promoting effect of ACTR6 on liver cancer in vivo and in vitro.
Although this study preliminarily explored a possible mechanism through which ACTR6 dares lung cancer progression, it still has limitations. First, clinical samples were not used in this study, so the feasibility and effectiveness of the results of this study in clinical treatment cannot be proven. Clinical samples of patients with liver cancer should be used in subsequent studies to further prove the findings of this study. Second, this study introduced a new possible target for the treatment of liver cancer and elucidated the possible regulatory mechanisms of ACTR6. In consideration of the growth and metastasis of tumors, the effects of ACTR6 on EMT and other processes should be explored in the future.
SUMMARY
In this study, we investigated ACTR6, a potential new target for future intervention in liver cancer that is highly expressed in HuH-7 cells. In vitro and in vivo experiments showed that ACTR6 likely maintains the stemness of liver cancer cells through Hh signaling and can be used as a potential marker for targeted liver cancer therapy.
AVAILABILITY OF DATA AND MATERIALS
The datasets used and/or analyzed during the current study were available from the corresponding author on reasonable request.
ABBREVIATIONS
ACTR6: Actin-related protein 6
ATCC: American Type Culture Collection
DAPI: 4 ‘: 6-diamino-2 ‘-phenylindole
DMEM: Dulbecco Modified Eagle Medium
ECL: Enhanced chemiluminescence
EdU: 5-ethynyl-2’-deoxyuridine
FBS: Fetal bovine serum
HCC: hepatocellular carcinoma
Hh: Hedgehog
LCSC: Liver cancer stem cells
PBS: Phosphate-buffered saline
Ptch1: Patched 1
SDS-PAGE: Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
SMO: Smoothened
AUTHOR CONTRIBUTIONS
CWJ and XQX: Designed the study; all authors conducted the study; AZZ and XQX: Collected and analyzed the data. LCZ and CWJ: Participated in drafting the manuscript, and all authors contributed to the critical revision of the manuscript for important intellectual content. All authors gave final approval of the version to be published. All authors participated fully in the work, took public responsibility for appropriate portions of the content, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or completeness of any part of the work were appropriately investigated and resolved. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Shandong Provincial Hospital Affiliated to Shandong First Medical University. The study was approved by the Institutional Animal Care and Use Committee of Shandong Provincial Hospital Affiliated with Shandong First Medical University (NO. HRSF-2022-0050). Informed consent to participate is not required, as this study does not involve human subjects.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Not applicable.
References
- Annual report to the nation on the status of cancer, 1975-2014, featuring survival. J Natl Cancer Inst. 2017;109:djx030.
- [CrossRef] [Google Scholar]
- Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209-49.
- [CrossRef] [PubMed] [Google Scholar]
- The past, present, and future of liver cancer research in China. Cancer Lett. 2023;574:216334.
- [CrossRef] [PubMed] [Google Scholar]
- Mitochondrial oxidative metabolism contributes to a cancer stem cell phenotype in cholangiocarcinoma. J Hepatol. 2021;74:1373-85.
- [CrossRef] [PubMed] [Google Scholar]
- A positive feedback loop between cancer stem-like cells and tumor-associated neutrophils controls hepatocellular carcinoma progression. Hepatology. 2019;70:1214-30.
- [CrossRef] [PubMed] [Google Scholar]
- IL-17A secreted from lymphatic endothelial cells promotes tumorigenesis by upregulation of PD-L1 in hepatoma stem cells. J Hepatol. 2019;71:1206-15.
- [CrossRef] [PubMed] [Google Scholar]
- CXCL11 promotes self-renewal and tumorigenicity of rigenicity of self-renewal and, Li M, sllsa stem cells.tumor-asso. Cancer Lett. 2019;449:163-71.
- [CrossRef] [PubMed] [Google Scholar]
- Mechanism of cancer stemness maintenance in human liver cancer. Cell Death Disease. 2022;13:394.
- [CrossRef] [PubMed] [Google Scholar]
- Hedgehog pathway and cancer: A new area. Oncol Rep. 2024;52:116.
- [CrossRef] [PubMed] [Google Scholar]
- Targeting the hedgehog pathway in MET mutation cancers and its effects on cells associated with cancer development. Cell Commun Signal. 2023;21:313.
- [CrossRef] [PubMed] [Google Scholar]
- The role of smoothened-dependent and-independent hedgehog signaling pathway in tumorigenesis. Biomedicines. 2021;9:1188.
- [CrossRef] [PubMed] [Google Scholar]
- Spatial density and distribution of tumor-associated macrophages predict survival in non-small cell lung carcinoma. Cancer Res. 2020;80:4414-25.
- [CrossRef] [PubMed] [Google Scholar]
- Dynamics and interplay of nuclear architecture, genome organization, and gene expression. Genes Dev. 2007;21:3027-43.
- [CrossRef] [PubMed] [Google Scholar]
- Actin in transcription and transcription regulation. Curr Opin Cell Biol. 2006;18:261-6.
- [CrossRef] [PubMed] [Google Scholar]
- Hedgehog signalling mediates drug resistance through targeting TAP1 in hepatocellular carcinoma. J Cell Mol Med. 2020;24:4298-311.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular pathways of liver regeneration: A comprehensive review. World J Hepatol. 2021;13:270.
- [CrossRef] [PubMed] [Google Scholar]
- Therapeutic effect of curcumin in gastrointestinal cancers: A comprehensive review. Phytother Res. 2021;35:4834-97.
- [CrossRef] [PubMed] [Google Scholar]
- Tumor-derived GLI1 promotes remodeling of the immune tumor microenvironment in melanoma. J Exp Clin Cancer Res. 2024;43:214.
- [CrossRef] [PubMed] [Google Scholar]