Translate this page into:
Alginate oligosaccharides alleviates gestational diabetes mellitus through reducing oxidative stress and improving gut microbiota
-
Received: ,
Accepted: ,
How to cite this article: Zhang P, Ding C, Wang Y, Du P, Tian M. Alginate oligosaccharides alleviates gestational diabetes mellitus through reducing oxidative stress and improving gut microbiota. CytoJournal. 2025;22:72. doi: 10.25259/Cytojournal_182_2024
Abstract
Objective:
Gestational diabetes mellitus (GDM) has significant implications for maternal and neonatal health and constitutes a considerable health challenge that requires intervention. The primary factors contributing to GDM are oxidative stress and dysbiosis of the gut microbiota. Alginate oligosaccharides (AOS), known for their antioxidant properties and ability to modulate the balance of gut microbiota, may offer a promising therapeutic option for managing GDM. In this investigation, we aim to clarify the specific therapeutic effects and underlying mechanisms of AOS in GDM.
Material and Methods:
Mice with GDM were administered various agents, including AOS and deltamethrin, to investigate the impact of AOS on gut microbiota composition, insulin resistance (IR), pancreatic cell apoptosis, and hepatic gluconeogenesis. Biochemical markers associated with GDM, IR, and hepatic gluconeogenesis were analyzed. Cell experiments were introduced to confirm the effects of AOS on high-glucose-induced liver cell damage.
Results:
Mice with GDM exhibited an imbalance in the gut microbiota, increased IR, enhanced liver gluconeogenesis, and activated the nuclear factor-erythroid 2 related factor 2/heme oxygenase-1 pathway in the liver. The administration of AOS restored gut microbiota equilibrium and reduced cell apoptosis in pancreatic cells, oxidative stress, IR, and hepatic gluconeogenesis, leading to improvements in parameters associated with islet β-cell functionality and insulin sensitivity. AOS also increased cell viability and decreased the inflammatory cytokine release induced by high glucose in QSG 7701 liver cells.
Conclusion:
Treatment with AOS offers protection against IR, and hepatic gluconeogenesis by diminishing oxidative stress and modulating the gut microbiota in mice with GDM. Hence, AOS is a promising intervention for GDM.
Keywords
Alginate oligosaccharides
Gestational diabetes mellitus
Gut microbiota
Nuclear factor-erythroid 2 related factor 2/heme oxygenase-1 pathway
Oxidative stress
INTRODUCTION
In the context of the global obesity epidemic and its associated metabolic disorders, gestational diabetes mellitus (GDM) is acknowledged as the most prevailing complication related to pregnancy. It is characterized by glucose intolerance that emerges during gestation. This condition is linked to several adverse outcomes, including preterm birth, increased incidence of cesarean deliveries, and development of preeclampsia.[1] Furthermore, antenatal exposure to maternal hyperglycemia can result in fetal hyperinsulinemia, increasing the probability of macrosomia, neonatal hypoglycemia, and hyperbilirubinemia.
In GDM, pancreatic β-cells were incapable of sufficiently making compensation for the increased insulin resistance (IR), leading to the normalization of systemic glucose levels and, ultimately, maternal hyperglycemia.[2] GDM is recognized as a multifactorial condition, with significant contributions from internal genetic and external environmental factors.[3] A hyperglycemic environment is associated with oxidative stress, and GDM leads to elevated levels of oxidative stress compared with those without complications, which exposes the embryo and fetus to harmful effects.[4]
A recent research highlighted a strong association between alterations in the gut microbiome of obese women during early pregnancy and changes in metabolic hormones.[5] Overweight pregnant women have an increased prevalence of pathogenic bacteria, such as Enterobacteriaceae and Staphylococcus, alongside a decrease in beneficial bacteria, such as Bifidobacteria and Bacteroides.[6] Several reports indicate significant changes in the gut microbiome of women with GDM, which are very similar to the microbiome characteristics observed in adults with non-insulin-dependent diabetes or so-called type II diabetes mellitus.[7-9] Probiotic interventions, including Lactobacillus rhamnosus GG and Bifidobacterium animalis subsp. lactis BB-12, in conjunction with dietary changes, have demonstrated efficacy in reducing the risk of GDM. Therefore, the gut microbiome may serve as a potential biomarker for impaired glucose metabolism during pregnancy, and its modulation could represent a promising strategy for improving health outcomes in women with GDM.
Sodium alginate is a linear acidic polysaccharide that possesses chelating, gelling, and hydrophilic properties, which confer its extensive applications in the food, cosmetics, and biomedical industries. Emerging evidence suggests that sodium alginate can function as a therapeutic adjuvant to enhance antitumor immune responses against various cancers, including ovarian cancer and melanoma.[10] However, its applications in biomedicine are significantly constrained by its low bioavailability. To address these challenges, sodium alginate can be artificially degraded to produce low-molecular-weight, low-viscosity alginate oligosaccharides (AOS), which exhibit improved solubility and bioavailability.
Consequently, AOS has garnered considerable attention for its enhanced pharmacological activity and beneficial effects in biomedical applications.[11] Furthermore, AOS demonstrates a diverse range of pharmacological effects, including antioxidant properties,[12] immune response modulation,[13] and lipid reduction.[14] The pharmacological effects of AOS align with the etiological factors associated with GDM, indicating its potential use as a treatment for this condition. Nevertheless, research investigating the efficacy of AOS in alleviating GDM remains limited.
In this investigation, we seek to clarify the impacts and biological mechanisms of AOS in GDM using a drug-induced mouse model of diabetes. We evaluated changes in blood glucose levels, gut microbiota composition, IR, pancreatic cell apoptosis, and liver gluconeogenesis following AOS treatment. The findings suggest that AOS effectively reduces IR, pancreatic cell apoptosis, and liver gluconeogenesis by alleviating oxidative stress and enhancing gut microbiota in mice with GDM. Results indicate that AOS may represent a viable treatment option for GDM and has potential clinical implications.
MATERIAL AND METHODS
Establish GDM mouse models
Diabetes mouse models were constructed based on previous literature.[15] Ninety 8 ± 2 weeks old C57BL/6J female mice, which weighed 23 ± 2 g, were obtained (Guangdong Experimental Animal Center, Guangzhou, China). The mice were kept in an environment regulated to approximately 25°C, with relative humidity levels fluctuating between 38% and 68%, and were subjected to natural light exposure. They were provided with standard laboratory chow with a completely unrestricted food and water supply. The experimental procedures began following a 1-week acclimatization period.
A mouse model of GDM was developed by the administration of streptozotocin (STZ, V900890, Sigma-Aldrich, St. Louis, USA) through the intraperitoneal route. Before the initiation of experimental procedures, venous blood samples were obtained from the tails of the mice to evaluate fasting blood glucose (FBG) levels, with a normal range defined as 3-5 mmol/L. Glucose oxidase was measured using a Glucose Assay Kit (MAK476, Sigma-Aldrich, St. Louis, USA). These measurements were performed using an automatic biochemical analyzer (7180, Hitachi, Tokyo, Japan). The estrous cycle of the mice was monitored utilizing the vaginal smear technique. In the initial stage of estrus, mice were matched pairs for copulation, and the emergence of a vaginal plug was assessed the following morning to confirm successful mating. The detection of the vaginal plug marks the 1st day of pregnancy. Eighty-two pregnant mice were in abrosia for 12-h while they were permitted free access to water on the 6th day of pregnancy. Ten mice were randomly selected for the control group, while 72 mice were placed into the GDM group. At 7 days post-modeling, an FBG level of ≥ 11.1 mmol/L was determined to be the significant symbol of the establishment of the GDM model. These mice were given 3 mg/kg AOS every day by oral gavage. Deltamethrin (5.6 mg/kg, 45423, Sigma-Aldrich, St.Louis, USA) was treated by oral gavage.
Animal anesthesia and euthanasia
To minimize distress experienced by experimental animals during procedures, this study utilized pentobarbital sodium (P3761, Sigma-Aldrich, St. Louis, USA) as an anesthetic agent. The anesthetic effects of pentobarbital sodium are relatively short-lived, with an effective duration of approximately 2-4 h following a single dose. For administration, a 2% pentobarbital sodium solution was prepared using physiological saline, which may be warmed if necessary to facilitate dissolution. The prepared solution was stored at room temperature for a maximum of 2 months without significant loss of potency. The mice received anesthesia through intraperitoneal injection of 40-45 mg/kg pentobarbital sodium.
To mitigate stress and suffering in murine subjects, researchers must undergo specialized training and successfully complete an evaluation before employing the euthanasia technique. During the procedure, the mouse is positioned on a wire mesh surface while the experimenter secures the mouse’s tail with one hand. With the thumb and index finger of the opposite hand, the experimenter applies swift and forceful pressure to the mouse’s head. Tweezers may be used to grasp the mouse’s neck, followed by a pulling motion to dislocate the cervical vertebrae.
Hematoxylin and eosin (HE) staining
Pancreatic tissue of mice in each experimental group was collected. The tissues were fixed with a 4% paraformaldehyde fixative solution (P0099, Beyotime, Shanghai, China), followed by decalcification, paraffin embedding, and storage at 4°C. Following the sectioning of the tissues into 5 μm slices, HE staining was performed utilizing a HE Staining Kit (C0105S, Beyotime, Shanghai, China). The sections were subjected to hematoxylin staining for 10 min and immersed in 70% ethanol (65350-M, Sigma-Aldrich, St. Louis, USA) for 30 min to remove cytoplasmic coloration. Following alkalization, the tissue sections were subjected to eosin staining for 60 s, dehydrated through a series of ethanol gradients, and cleared twice using Stoddard solvent (ST975, Beyotime, Shanghai, China). The samples were then dried for further analysis. The morphological particularity of the pancreas was assessed utilizing an optical microscope (B-510ASB, Optika, Shanghai, China). The nuclei were predominantly stained a black-blue color, while the cytoplasm exhibited a pale red hue.
Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay
After treatment for 6 weeks, the pancreas of mice in each experimental group was surgically removed, collected, and subjected to staining using TUNEL Apoptosis Detection Kit (C1091, Beyotime, Shanghai, China). The stained tissues were subsequently examined with an optical microscope. Five high-power fields demonstrating the greatest quantity of positively stained cells, as indicated by brown-stained nuclei, were selected from each group at a magnification of ×400.
Detection of biochemical indicators
Venous blood samples were collected from the tails of mice in each experimental group 1 day before euthanasia. The samples were centrifuged (12,000 rpm, 15 min) to boost the separation of the serum. FBG levels were assessed. Serum fasting insulin (FINS) levels were determined using a mouse insulin enzyme-linked immunosorbent assay (ELISA) kit (E03I0004, Bluegene, Shanghai, China). The values of FBG and FINS that were obtained were subsequently employed to compute and evaluate the homeostasis model assessment (HOMA) indices, which specifically pertain to Homeostatic Model Assessment of Insulin Resistance (HOMA-IRI), islet β-cell function (HOMA-β%) and insulin sensitivity (HOMA-ISI). Blood parameters were assessed through glucose tolerance tests and insulin tolerance tests. Serum samples were obtained by subjecting blood to centrifugation (1,000 g, 10 min, and 4°C). Liver tissue samples were collected for biochemical assessments. Blood lipid markers, such as serum total cholesterol (TChl) and triglycerides (TG), were assessed using specific detection kits (TChl: Amplex Red Cholesterol and Cholesteryl Ester Assay Kit, S0211S, Beyotime, Shanghai, China; TG: Amplex Red TG Assay Kit, S0219S, Beyotime, Shanghai, China; High-Density Lipoprotein Cholesterol Content Assay Kit, 60737ES, Yeasen, Shanghai, China; LDL: Low-Density Lipoprotein Cholesterol Content Assay kit, 60736ES, Yeasen, Shanghai, China; Malondialdehyde [MDA]: Colorimetric MDA assay kit,60745ES, Yeasen, Shanghai, China). Liver lysates were prepared following a standardized protocol, and the levels of MDA, superoxide dismutase (SOD), glutathione peroxidase (GPx), glutathione (GSH), and catalase (CAT) in the hepatic tissue were measured using detection kits (SOD: Total SOD Assay Kit with WST-8, S0101S, Beyotime, Shanghai, China; GPx: Cellular GPx Assay Kit with NADPH, S0056, Beyotime, Shanghai, China; GSH: Total GSH Assay Kit, S0059S, Beyotime, Shanghai, China; CAT Assay Kit, S0051, Beyotime, Shanghai, China).
Reverse-transcription polymerase chain reaction (RT-PCR)
Total RNA was isolated from the harvested hepatic tissues using the RNA Easy Fast kit (DP451, TianGen, Beijing, China) and applied to synthesize complementary DNA (cDNA) with Hieff NGS® ds-cDNA Synthesis Kit (13488ES24, Yeasen, Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was utilized as the internal control. All primers utilized in this study were synthesized by Qingke Biotech (Guangzhou, China) [Table 1].[16] The relative messenger ribonucleic acid (mRNA) expression levels of the target genes were assessed through quantitative RT-PCR (qRT-PCR) using a BeyoFast™ Synergetic Binding Reagent Green One-Step qRT-PCR Kit (D7268S, Beyotime, Shanghai, China). The ΔΔCt method was employed to calculate relative mRNA expression levels in comparison with the control group.
| Gene | Forward (5'-3') | Reverse (5'-3') |
|---|---|---|
| G-6-Pase | CACCTGTGAGACCGGACCA | GACCATAACATAGTATACACCTGCTGC |
| GLUT2 | TACGGCAATGGCTTTATC | CCTCCTGCAACTTCTCAAT |
| PEPCK | GACCATAACATAGTATACACCTGCTGC | AGAAGGGTCGCATGGCAA |
| GAPDH | AATGGTGAAGGTCGGTGTGAACG | TCGCTCCTGGAAGATGGTGATGG |
RT-qPCR: Reverse-transcription quantitative polymerase chain reaction, G-6-Pase: Glucose-6-phosphatase G-6-pase, GLUT2: Glucose transporter 2, PEPCK: Phosphoenolpyruvate carboxykinase, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
Western blot analysis
Nuclear and cytoplasmic proteins were isolated using a Nuclear and Cytoplasmic Protein Extraction Kit (P0027, Beyotime, Shanghai, China). Two buffer solutions were formulated, designated as buffer A and buffer B. Buffer A is composed of 10 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 250 mM sucrose, whereas buffer B comprises 10 mM Tris-HCl (pH 7.4), 1 mM MgCl2, and 2 M sucrose. About 500 mg of liver tissue was homogenized using a 40 μm cell filter in 2 mL of ice-cold buffer A to generate a liver nuclear lysate. Following centrifugation (500 g, 15 min, and 4°C) and washing with buffer A, the resultant pellet was resuspended in 8 times its volume of buffer B. The mixture was then centrifuged (16,000 g, 30 min, and 4°C). The upper brown layer was abandoned, and the white pellet at the bottom was retained. The granules in the bottom layer (white) are the nuclei, while those in the upper brown layer are cytoplasm. We prepared samples of nuclear protein and total cellular protein as described. A total of 30 μg of the protein in each group was subjected to separation using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) Gel Quick Preparation Kit (P0012AC, Beyotime, Shanghai, China) and transferred to a polyvinylidene fluoride membrane (IPFL00010, Millipore, USA). The membrane was blocked with 5% skim milk in ×1 Tris-buffered saline (TBS) (ST661, Beyotime, Shanghai, China) for 1 h. The membranes were subjected to an overnight incubation at 4°C with primary antibodies, after which they were washed 3 times with 0.05% Tween-20 in TBS. The membranes were then treated with horseradish peroxidase-labeled goat anti-rabbit Immunoglobulin G (H + L) (A0208, Beyotime Biotechnology, China) for 1 h. Following a 1-min incubation period with the enhanced chemiluminescence (ECL) solution (36222, Yeasen, Shanghai, China), the resultant signals were measured utilizing an ECL detection system (ImageQuant LAS 4000, GE, Boston, USA). The blots were probed with the following primary antibodies: Rabbit anti-rat nuclear respiratory factor 2 (Nrf2) (1:1000) (#ab313825, Abcam, Cambridge, UK) and rabbit anti-rat Heme oxygenase 1 (HO-1) (1:10000) (#ab189491, Abcam, Cambridge, UK) as well as rabbit anti-rat histone 3 antibody (1:2000) (#60538, CST, Danvers, USA) and rabbit anti-rat β-actin (1:5000) (#ab179467, Abcam, Cambridge, UK). The T-test method was employed to calculate relative protein expression levels in comparison with the control group.
Intestinal microbiota composition analysis
In accordance with the manufacturer’s protocols, genomic DNA was extracted from the entire microbial community utilizing the MolPure® Stool DNA Kit (18820E, Yeasen, Shanghai, China). The bacterial DNA extraction protocol utilized modified variants of the upstream primer 338F (5'-ATCCTACGGGGGCAGCAG-3') and the downstream primer 806R (5'-GGATCAVGGGTWTCTAAT-3') to amplify the V3-V4 hypervariable region of the 16S ribosomal ribonucleic acid gene. Polymerase chain reaction (PCR) amplification was conducted using the ETC821D PCR thermal cycler (Eastwin, Beijing, China). The purified PCR products were subsequently processed with the NEXTFLEX Rapid DNA-Seq Kit (5144-08, Bioo Scientific, Austin, USA) and sequenced on the Illumina MiSeq PE300 platform (Illumina, San Diego, CA). The sequencing data were analyzed by Qingke Biotech (Guangzhou, China).
Cell culture and treatment
The human-derived normal liver cell line (QSG 7701) was purchased from Biyun Tian Biotechnology Co., Ltd. (Shanghai, China) and identified by short tandem repeat. MycAwayTM Plus-Color One-Step Mycoplasma Detection Kit (40612E, Yeasen, Shanghai, China) was used to detect mycoplasma, and no contamination was found. QSG 7701 cells were cultured using Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (12103C, Sigma-Aldrich, St. Louis, USA), 1% penicillin, and 1% streptomycin at 37°C under an atmosphere of 5% Carbon dioxide. The cells were treated at a density of approximately 80%. We employed high-glucose (30 mmol/L) treatment for 48 h to induce damage in QSG 7701 cells, thereby modeling the hepatic injury associated with glucose dysregulation in the organism. Low glucose concentration (11.1 mmol/L) was used act as the control group. High-glucose QSG 7701 cells treated with 0.05, 0.1, 0.2, and 0.3 nM AOS were harvested at 48 h. Cell viability was assessed after 48 h of treatment.
Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay
Cells were initially plated at a density of 5 × 105 cells per well in six-well plates. After 24 h, the cells were incubated with varying concentrations of AOS (0.05, 0.1, 0.2, and 0.3 nM) and re-plated at a density of 1 × 104 cells per well in 96-well plates. After being incubated under low- and high-glucose conditions for an additional 48 h, 10 μL of MTT solution (5 mg/mL) was added to each well, and the plates were incubated at 37°C for 2 h. Each well was added with 200 μL of dimethyl sulfoxide and incubated again for 30 min. Cell viability was determined by recording the absorbance at 570 nm using a microplate reader (1681130, Bio-rad, California, USA). Cell counts were expressed as a percentage relative to the control group.
ELISA
Blood samples were centrifuged at 750 g for 20 min. The serum was separated and stored at −80°C. The levels of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α (TNF-α) in the mouse serum samples were analyzed using sandwich ELISA kits (Mouse IL-1β: MM-0040M1, mmbio, Jiangsu, CHINA; mouse IL-6:MM-1011M2, mmbio, Jiangsu, CHINA; mouse TNF-α: MM-0132M2, mmbio, Jiangsu, CHINA) in accordance with the supplier’s protocol. The data were plotted as bar graphs.
Reactive oxygen species (ROS) assay
QSG 7701 cells were inoculated into a six-well plate at a concentration of 5 × 105 cells per well to ensure that the cell confluence reached 50-70% during detection.
The cells should be healthy and not overgrown during the experiment. The cells were treated according to the aforementioned experimental protocol and incubated in a 37°C cell culture incubator in the dark for 48 h. ROS assay was conducted using a ROS assay kit (S0033S, Beyotime, Shanghai, China). Before loading the probe, 2',7'– dichlorofluorescein diacetate (DCFH-DA) was diluted with serum-free culture medium at a ratio of 1:1000 to achieve a final concentration of 10 μM. The cell culture medium was removed and added with 1000 μL of the diluted DCFH-DA working solution. The cells were incubated at 37°C in a dark incubator for 20-30 min and washed 3 times with serum-free culture medium to thoroughly remove any unincorporated DCFHDA. Finally, the cells were observed under a fluorescence microscope (MIX60-FL, Mshot, Guangzhou, China).
Statistical analysis
The Statistical Package for the Social Sciences version 21.0 (IBM Corp., Armonk, NY, USA) was used for statistical analyses.
Results are expressed as mean ± standard deviation. Before analysis, all data were evaluated for normality and homogeneity of variance. Comparisons between two groups were executed using t-test, whereas comparisons among multiple groups were carried out using a one-way analysis of variance. P < 0.05 was deemed statistically significant, with significance levels indicated as ✶P < 0.05, ✶✶P < 0.01, and ✶✶✶P < 0.001 compared with the control group.
RESULTS
AOS alleviates symptoms associated with hyperlipidemia resulting from GDM
Following the modeling procedure, all random blood glucose levels exceeded 16.7 mmol/L and were associated with symptoms, including polydipsia, polyphagia, and polyuria, indicating that the modeling was successful. In the animal model used for investigation, all mice administered with STZ exhibited fasting blood sugar levels surpassing 16.7 mmol/L, thereby confirming the efficacy of the modeling process. The concentrations of not only IL-6 but also TNF-α in the diabetes/AOS group were dramatically lower than those observed in the control group [Figure 1a]. Moreover, TCh, TG, LDL, and the atherosclerosis index in diabetes/AOS mice were prominently descended compared with the diabetes/ control group [Figure 1b-f]. All these align with the results of the glucose/insulin tolerance test, further substantiating the hypothesis that AOS supplementation improves biochemical indicators and promotes metabolic balance in GDM mice.

AOS mitigates oxidative stress in GDM mice
The serum and liver levels of MDA in diabetic and control mice were elevated relative to the wild-type group; however, these levels exhibited a significant reduction following AOS treatment, mirroring the trends observed in the astaxanthin-treated cohort [Figure 2a and b]. In addition, the study analyzed the activity of critical antioxidant enzymes, such as SOD, in the liver. Treatment with AOS significantly improved the functionality of antioxidant defenses in pregnant mice in comparison with untreated diabetic/control mice, consistent with the outcomes observed in the positive control group, while levels of GSH were markedly increased in the hepatic tissue of diabetic/control mice treated with AOS [Figure 2c-f]. These findings indicate that AOS mitigates oxidative stress in GDM mouse models.

AOS enhances the balance of gut microbiota dysbiosis
The fecal microbiota diversity and abundance in GDM mice were markedly diminished compared to those in the control group, while values of Shannon, Chao, and ACE indices increased following the administration of AOS [Figure 3a-d], indicating an enhancement in the abundance of the fecal microbiota. However, no significant changes in the diversity of the fecal microbiota were detected. Furthermore, β-diversity analysis revealed a reorganization of the gut microbiota subsequent to AOS treatment. The impact of AOS on the quantity of the gut microbiota was evaluated. The findings revealed notable inconsistencies in microbial components among various animal groups studied. In particular, the abundance of Verrucomicrobia and Akkermansia remarkably increased following AOS treatment, while the abundance of Proteobacteria, Klebsiella, Shigella, and Mucispirillum significantly decreased [Figure 3e-l]. Thus, AOS treatment plays a crucial role in mitigating dysbiosis within the gut microbiota.

AOS stimulates the Nrf2/HO-1 signaling pathway in GDM mice
The Nrf2/HO-1 signaling pathway is acknowledged as a critical regulator in antioxidant gene transcription and in maintaining redox homeostasis. Here, we examined the activation of the Nrf2/HO-1 signaling pathway, a vital role in maintaining redox homeostasis, in the hepatic tissue of GDM mice subjected to AOS treatment through Western blot analysis. Nrf2 expression in nuclear increased in the diabetic mice compared with that in wild-type mice, indicating a suppression of the Nrf2-dependent gene HO-1 [Figure 4a]. HO-1 is critical for heme detoxification and protection against oxidative stress. By contrast, the administration of AOS markedly elevated the levels of nuclear Nrf2 and HO-1 in the diabetic/control group mice [Figure 4b].

AOS reduces pancreatic cell apoptosis in GDM mice
Pathological changes in the pancreas associated with different treatment groups of mice emerged. The endocrine and exocrine components of the pancreas were clearly identifiable [Figure 5a]. The exocrine component was identified by the presence of serous acini exhibiting dark staining characteristics, whereas the endocrine component consisted of dispersed islets that demonstrated lighter staining. In the control group, the pancreatic islets were observed as rounded or oval clusters of cells with clearly delineated borders, lacking surrounding membranes. These structures contained a significant quantity of islets and cells.

In contrast to the control group, pancreatic islet atrophy was markedly intensified in the four other experimental groups. This phenomenon was correlated with a reduction in the cellular population within the islets, an increase in the deterioration of inflammatory lesions, and vacuolar degeneration in β-cells. AOS treatment executed a restoration of pancreatic islet architecture, as evidenced by the increased number of islets and cells, reduced inflammatory lesions, and improved regeneration of pancreatic islets. However, deltamethrin treatment counteracts these effects. These observations suggest that AOS treatment may facilitate the regeneration of pancreatic islets, thereby mitigating GDM in mice; however, these beneficial effects seem to be negated by deltamethrin, which acts as an inhibitor of the Nrf2/HO-1 signaling pathway.
TUNEL assay was conducted to evaluate cellular apoptosis in the pancreas. In comparison with the control group, the other experimental groups showed a statistically significant enhancement in cell apoptosis within the pancreas (P < 0.05, [Figure 5b]). Cell apoptosis in the pancreas was remarkably diminished after AOS treatment compared with that in the GDM group (P < 0.05). However, deltamethrin can counteract this effect (P < 0.05). The GDM + deltamethrin group exhibited a notable rise in cell apoptosis (P < 0.05). Therefore, AOS inhibits cell apoptosis in pancreatic tissues, but these effects are counteracted by deltamethrin.
AOS increases insulin sensitivity and rescues islet β-cell function in GDM mice
A comparative analysis with the control group indicated that the other experimental groups exhibited significantly elevated levels of FBG, FINS, and HOMA-IR [Table 2]. The GDM + AOS and GDM + AOS + deltamethrin groups demonstrated a significant decline in FBG, FINS, and HOMA-IR levels and an increase in HOMA-β% and HOMA-ISI (all P < 0.05). By contrast, the GDM + deltamethrin group displayed an opposing trend (all P < 0.05). Hence, AOS treatment may improve not only insulin sensitivity but also β-cell function, and these effects appear to be antagonized by deltamethrin.
| Biochemical index | NC | GDM | GDM+AOS | GDM+AOS+Deltamethrin | Deltamethrin |
|---|---|---|---|---|---|
| FBG (mmol/L) | 4.32±0.05 | 5.64±0.16 | 4.72±0.12 | 5.19±0.12 | 6.56±0.13 |
| FINS (μU/mL) | 10.35±0.08 | 21.28±0.67 | 14.97±0.22 | 17.97±0.22 | 23.62±0.85 |
| HOMA-IR | 2.10±0.02 | 5.28±0.26 | 3.18±0.07 | 5.18±0.07 | 6.79±0.33 |
| HOMA-β% | 392.71±39.14 | 232.21±18.14 | 326.74±41.95 | 256.74±41.95 | 172.17±6.95 |
| HOMA-ISI | −4.00±0.01 | −5.02±0.05 | −4.47±0.02 | −4.77±0.02 | −5.28±0.05 |
One-way ANOVA was conducted for the statistical analysis. This experiment was replicated 3 times. FBG: Fasting blood glucose, FINS: Fasting serum insulin, HOMA-IR: Homeostasis model assessment of insulin resistance, HOMA-β%: Homeostasis model assessment of β-cell function, HOMA-ISI: Homeostasis model assessment of insulin sensitivity, NC: Negative control, GDM: Gestational diabetes mellitus, AOS: Alginate oligosaccharides
AOS alleviates IR and gluconeogenesis in the hepatic tissue of GDM mice
The mRNA levels of gluconeogenesis genes, including phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G-6-Pase), and glucose transporter 2 (GLUT2), were evaluated using RT-PCR. The experimental groups exhibited a significant increase in the levels of both PEPCK and G-6-Pase, while GLUT2 levels were notably diminished in comparison with the control group (P < 0.05, [Figure 6a-c]). The mRNA expression of PEPCK and G-6-Pase was decreased in GDM + AOS and GDM + AOS + deltamethrin groups while simultaneously showing an increase in GLUT2 mRNA levels (all P < 0.05) compared to the GDM groups. Conversely, the GDM + deltamethrin group exhibited an opposing trend (P < 0.05). Hence, AOS treatment may play a role in alleviating IR and inhibiting gluconeogenesis in the hepatic tissue of GDM mice. Nevertheless, the beneficial effects appear to be counteracted by deltamethrin.

AOS alleviates the decline in cell viability and the increase in inflammatory cytokines in normal liver cells induced by high glucose
To validate the experimental results obtained from the animal studies, we conducted experiments at the cellular level. First, we simulated the glucose-disordered environment of QSG 7701 liver cells by incubating them in high-glucose concentrations. MTT assay was utilized to evaluate cell viability subsequent to a range of treatments. The high-glucose group exhibited a remarkable decrease in cell viability compared to the low-glucose group (P < 0.05). AOS treatment (0.2 nM and 0.3 nM) increased cell viability in a concentration-dependent manner [Figure 7a]. For the subsequent experiments, a treatment concentration of 0.2 nM was chosen. We utilized deltamethrin to inhibit the Nrf2/HO-1 signaling pathway and assessed the impact of AOS on cell viability. After treatment with deltamethrin, the increase in AOS-induced cell viability was counteracted (P < 0.05, [Figure 7b]).

ELISA was utilized to evaluate inflammatory cytokines, including TNF-α, IL-1, and IL-1 β, subsequent to a range of treatments. The high-glucose group exhibited a significant increase in inflammatory cytokines levels in comparison with the low-glucose group (P < 0.05). AOS treatment decreased the levels of inflammatory cytokines in a concentration-dependent manner compared to the high-glucose group.
We utilized deltamethrin to inhibit the Nrf2/HO-1 signaling pathway and assessed the impact of AOS on inflammatory cytokine release. After treatment with deltamethrin, the effect of AOS on inhibiting inflammatory cytokine release was counteracted (P < 0.05, [Figure 7c-e]). Moreover, the high-glucose group exhibited a significant risen in ROS production in comparison with the low-glucose group (P < 0.05). AOS treatment reduced ROS production, and this effect was counteracted by deltamethrin (P < 0.05, [Figure 7f]). The high-glucose group also exhibited a significant decrease in the Nrf2/HO-1 signaling pathway, with nuclear Nrf2 and HO-1 expression declined (P < 0.05). AOS treatment activated the Nrf2/HO-1 signaling pathway, and this effect was counteracted by deltamethrin (P < 0.05, [Figure 7g]). The findings collectively confirm that AOS treatment improves liver cell viability and inflammation induced by high glucose. Nevertheless, the beneficial effects appear to be counteracted by deltamethrin.
SUMMARY
Patients diagnosed with GDM frequently demonstrate ongoing IR and hyperglycemia, indicating potential common etiological factors and clinical characteristics with diabetes mellitus. Given the established connection between oxidative stress and mechanisms that contribute to IR and diabetes, antioxidants may offer beneficial effects in the prevention and management of GDM. Nonetheless, effective treatment strategies are urgently needed. We explored the impacts of antioxidant supplementation (AOS) on GDM by modulating oxidative stress and the gut microbiota, which may provide valuable functional insights. Treatment with AOS can regulate oxidative stress by positively influencing the Nrf2/HO-1 signaling pathway and enhancing the gut microbiota, thereby acting as an inhibitor of GDM. AOS exerts its antioxidant effects by increasing GSH levels, modulating gene expression and signaling pathways, and neutralizing ROS that can penetrate cell membranes, thereby protecting tissues and organs. AOS significantly elevates the concentration of short-chain fatty acids, such as acetate, propionate, and butyrate, while simultaneously decreasing endotoxin levels. Furthermore, AOS can alleviate metabolic disturbances associated with a high-fat diet. It also exhibits antioxidant properties, such as enhancing wound healing in diabetic mice by neutralizing free radicals.
In the past decade, studies have underscored the significant involvement of the balance of gut microbiota in GDM progression.[17] Here, we identified that the modulation of the balance of gut microbiota by AOS may represent a viable therapeutic strategy for managing GDM. We observed that AOS effectively regulates dysbiosis in the gut microbiota, resulting in a reduction in the abundance of Gram-negative bacteria and alleviating inflammation-induced damage.[18] Notably, Gram-negative bacteria are often enriched in individuals with diabetes.[19] Following AOS treatment, a substantial reduction was observed in the prevalence of Gram-negative bacteria, specifically Proteus, Klebsiella, and Escherichia coli. Previous studies reported an increase in Marvinbryantia abundance in diabetic nephropathy, which correlates positively with serum MDA levels and intestinal mucosal inflammatory markers, consistent with the present findings.[20] In comparison with GDM mice, AOS treatment reversed the abundance of Marvinbryantia. Considering the role of gut microbiota in maintaining intestinal epithelial integrity and protecting the intestinal barrier, these results suggested that AOS treatment enhances the protective effects of the gut microbiota and mitigates the detrimental impact of hyperglycemia on vital organs.
Due to the intricate connection between glucose and lipid metabolism, the development of GDM is linked to dysregulations in lipid metabolic processes.[21] Following AOS treatment, the levels of TG and total cholesterol reversed in GDM mice, indicating that it effectively ameliorates lipid abnormalities induced by GDM, which is also characterized by disturbances in glucose metabolism.[22] Hyperglycemia-induced abnormalities in glucose metabolism can catalyze the production of excessive ROS, thereby exacerbating oxidative stress. SOD and CAT are essential enzymes that mitigate free radical damage, while MDA functions as a biomarker for lipid peroxidation and indicates the degree of membrane impairment.[21] Our findings corroborate previous research, confirming that AOS treatment significantly enhances oxidative stress parameters, raises the concentrations of the antioxidant enzymes SOD and CAT, and lowers the levels of MDA. In addition, AOS treatment reversed the abundance of Marvinbryantia and improved the balance of gut microbiota. AOS treatment enhances the protective effects of the gut microbiota and mitigates the detrimental impact of hyperglycemia on vital organs. An expanding literature suggests that the Nrf2/HO-1 signaling pathway plays a protective role in various diseases.[23] For instance, the activation of the Nrf2/HO-1 pathway can reduce oxidative stress damage in human lung epithelial cells. Nrf2 was transported to the nucleus, where it binds to specific DNA sequences in response to oxidative stress by initiating the transcription of cytoprotective genes, such as HO-1.[24] Nrf2 activation carries out cardio-protection effects by promoting antioxidant and anti-inflammatory thus alleviating myocardial oxidative stress in diabetic hearts.[25,26] HO-1 facilitates the degradation of heme into carbon monoxide, biliverdin, and ferrous iron, thereby conferring cardio-protection through anti-apoptotic and antioxidant effects. It is also involved in ferroptosis due to its relationship to iron and antioxidant functions.[27] We hypothesized that AOS mitigates oxidative stress by modulating the Nrf2/HO-1 pathway in GDM mice. A significant reduction in the expression levels of Nrf2 and HO-1 in GDM mice was observed, which was restored following AOS treatment. Functional rescue experiments demonstrated that the suppression of Nrf2/HO-1 signaling reduced the protective effects of AOS in GDM mice. Furthermore, we conducted cellular experiments to validate the findings obtained from the animal studies. Our results indicated that exposure to elevated glucose levels resulted in a decrease in liver cell viability and an increase in the release of inflammatory mediators. Following the administration of AOS, the decline in cell viability induced by high glucose was alleviated, and the release of inflammatory factors was suppressed; however, this protective effect was negated by the application of Nrf2/HO-1 signaling inhibitors.
AOS inhibits IR and hepatic gluconeogenesis induced by diabetes via the Nrf2/HO-1 pathway and the equilibrium of the balance of gut microbiota. In this study, the primary innovation lies in elucidating the effects and the underlying biological mechanisms of AOS on GDM mice. However, the involvement of additional signaling pathways in the protective mechanisms of AOS remains to be determined. Moreover, the possible impact of AOS on additional elements, including microRNA and mRNA, necessitates further exploration. Subsequent studies should elucidate the precise mechanisms underlying various signaling pathways and evaluate the therapeutic potential of AOS for GDM to establish a theoretical foundation for the management of implications.
AVAILABILITY OF DATA AND MATERIALS
The authors confirm that the data supporting the findings of this study are available within the article.
ABBREVIATIONS
GDM: Gestational diabetes mellitus
AOS: Alginate oligosaccharides
FBG: Fasting blood glucose
FINS: Serum fasting insulin
HOMA: Homeostasis model assessment
TChl: Total cholesterol
TG: Triglycerides
HDL: High density lipoprotein cholesterol
LDL: Low density lipoprotein cholesterol
MDA: Malondialdehyde
SOD: Superoxide dismutase
GPx: Glutathione peroxidase
GSH: Glutathione
CAT: Catalase
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
G-6-Pase: Glucose-6-phosphatase G-6-pase
GLUT2: Glucose transporter 2
PEPCK: Phosphoenolpyruvate carboxykinase
ELISA: Enzyme-linked Immunosorbent assay
IL: Interleukin
TNF-α: Tumor necrosis factor-α
ROS: Reactive oxygen species
AUTHOR CONTRIBUTIONS
MLT: Research design and supervision; PZ: Experimental operations and statistical analysis; MLT: Manuscript writing and revisions; CQD: Reviews and modifications; PD and YW: Experimental implementation and data statistics; and MLT: Financial support. All authors meet the authorship status of ICMJE.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All the animals were acclimated under standard laboratory conditions (ventilated room, 25 ± 1°C, relative humidity levels fluctuating between 38% and 68%, 12 h light/dark cycle) and had free access to standard water and food. All procedures were conducted in accordance with the “Guiding Principles in the Care and Use of Animals” (China) and were approved by the Laboratory Animal Ethics Committee of Hebei General Hospital (KY-2024-0011-02). Informed consent to participate is not required as this study does not involve human experiments.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: This paper is supported by the Youth Science and technology project of Hebei Health Commission under grant No.20200001.
References
- Gestational diabetes mellitus. Endocrinol Metab Clin North Am. 2019;48:479-93.
- [CrossRef] [PubMed] [Google Scholar]
- The pathophysiology of gestational diabetes mellitus. Int J Mol Sci. 2018;19:3342.
- [CrossRef] [PubMed] [Google Scholar]
- Type 2 diabetes in youth: The role of early life exposures. Curr Diab Rep. 2020;20:45.
- [CrossRef] [PubMed] [Google Scholar]
- Effect of endogenic and exogenic oxidative stress triggers on adverse pregnancy outcomes: Preeclampsia, fetal growth restriction, gestational diabetes mellitus and preterm birth. Int J Mol Sci. 2021;22:10122.
- [CrossRef] [PubMed] [Google Scholar]
- Connections between the gut microbiome and metabolic hormones in early pregnancy in overweight and obese women. Diabetes. 2016;65:2214-23.
- [CrossRef] [PubMed] [Google Scholar]
- Gut microbiota in obesity and metabolic disorders. Proc Nutr Soc. 2010;69:434-41.
- [CrossRef] [PubMed] [Google Scholar]
- Connections between the human gut microbiome and gestational diabetes mellitus. Gigascience. 2017;6:1-12.
- [CrossRef] [Google Scholar]
- Gestational diabetes is associated with change in the gut microbiota composition in third trimester of pregnancy and postpartum. Microbiome. 2018;6:89.
- [CrossRef] [PubMed] [Google Scholar]
- Changes in the gut microbiota composition during pregnancy in patients with gestational diabetes mellitus (GDM) Sci Rep. 2018;8:12216.
- [CrossRef] [PubMed] [Google Scholar]
- Sodium alginate and alginic acid as pharmaceutical excipients for tablet formulation: Structure-function relationship. Carbohydr Polym. 2021;270:118399.
- [CrossRef] [PubMed] [Google Scholar]
- Alginate oligosaccharides: The structure-function relationships and the directional preparation for application. Carbohydr Polym. 2022;284:119225.
- [CrossRef] [PubMed] [Google Scholar]
- Alginate oligosaccharides: Enzymatic preparation and antioxidant property evaluation. Food Chem. 2014;164:185-94.
- [CrossRef] [PubMed] [Google Scholar]
- An exploration of alginate oligosaccharides modulating intestinal inflammatory networks via gut microbiota. Front Microbiol. 2023;14:1072151.
- [CrossRef] [PubMed] [Google Scholar]
- Alginate oligosaccharide improves lipid metabolism and inflammation by modulating gut microbiota in high-fat diet fed mice. Appl Microbiol Biotechnol. 2020;104:3541-54.
- [CrossRef] [PubMed] [Google Scholar]
- Animal models in diabetes and pregnancy. Endocr Rev. 2010;31:680-701.
- [CrossRef] [PubMed] [Google Scholar]
- N-acetyl-L-cysteine ameliorates gestational diabetes mellitus by inhibiting oxidative stress. Biotechnol Appl Biochem. 2023;70(3):1128-1136.
- [CrossRef] [PubMed] [Google Scholar]
- Gut microbiota and gestational diabetes mellitus: A systematic review. Diabetes Res Clin Pract. 2021;180:109078.
- [CrossRef] [PubMed] [Google Scholar]
- Targeting LPS biosynthesis and transport in gram-negative bacteria in the era of multi-drug resistance. Biochim Biophys Acta Mol Cell Res. 2023;1870:119407.
- [CrossRef] [PubMed] [Google Scholar]
- Altered gut bacterial and metabolic signatures and their interaction in gestational diabetes mellitus. Gut Microbes. 2020;12:1-13.
- [CrossRef] [Google Scholar]
- Association between gut microbiota and diabetic nephropathy: A mendelian randomization study. Front Microbiol. 2024;15:1309871.
- [CrossRef] [Google Scholar]
- Association between serum lipid profile during the first and second trimester of pregnancy as well as their dynamic changes and gestational diabetes mellitus in twin pregnancies: A retrospective cohort study. Diabetol Metab Syndr. 2023;15:125.
- [CrossRef] [PubMed] [Google Scholar]
- The effects of probiotics/ synbiotics on glucose and lipid metabolism in women with gestational diabetes mellitus: A meta-analysis of randomized controlled trials. Nutrients. 2023;15:1375.
- [CrossRef] [PubMed] [Google Scholar]
- Panaxydol attenuates ferroptosis against LPS-induced acute lung injury in mice by keap1-Nrf2/HO-1 pathway. J Transl Med. 2021;19:96.
- [CrossRef] [PubMed] [Google Scholar]
- NRF2, a transcription factor for stress response and beyond. Int J Mol Sci. 2020;21:4777.
- [CrossRef] [PubMed] [Google Scholar]
- Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol. 2013;53:401-26.
- [CrossRef] [PubMed] [Google Scholar]
- CaMKK2 alleviates myocardial ischemia/reperfusion injury by inhibiting oxidative stress and inflammation via the action on the AMPK-AKT-GSK-3β/Nrf2 signaling cascade. Inflamm Res. 2023;72:1409-25.
- [CrossRef] [PubMed] [Google Scholar]
- Intravenous heme arginate induces HO-1 (heme oxygenase-1) in the human heart. Arterioscler Thromb Vasc Biol. 2018;38:2755-62.
- [CrossRef] [PubMed] [Google Scholar]

