Combine immune checkpoint indoleamine 2,3-dioxygenase 1 knockdown with ferroptosis inducer Erastin/RSL3 accelerates colorectal cancer cell ferroptosis

Cell culture and chemicals

The mouse colorectal carcinoma cell lines CT-26 (CL-0025) and MC-38 (CL-0605), along with the human colorectal carcinoma cell line HT-29 (CL-0138), were acquired from ProCell Life Science and Technology Co., Ltd. (Wuhan, China). In addition, the non-tumorigenic colonic epithelial cell line NCM460 (CL-0359) was procured from the same supplier. All cell lines were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (C11965500bt, Gibco, USA) containing with 10% heat-inactivated fetal bovine serum (FBS) (FSP500, Excell Bio, China) and antibiotic–antimycotic solution (100 U/mL penicillin and 100 µg/mL streptomycin, Q6532, MACKLIN, China). We maintained the cells at 37°C in a humidified incubator (Boxun biotechnology, Shanghai, China) containing 5% carbon dioxide. RSL3 (HY-100218A) and Erastin (HY-15763) were obtained from MedChem Express (USA). After 20 µmol/L Erastin or 4 µmol/L RSL3 treatment of the four cell lines for 24 h, cells were collected for messenger RNA (mRNA) and protein extraction. We sent the above cell lines to Xiamen Immocell Biotechnology Co. Ltd., and species identification and mycoplasma detection were performed.

Gene silencing and transduction

The National Center for Biotechnology Information database provided the IDO1 gene sequence [Supplementary Figure S1]. Gene-specific small interfering (si) RNAs against IDO1 and a scrambled negative control (si-NC) were commercially sourced from Suzhou Gemma Genetics (China). For transfection, 250 µL Lipofectamine 3000 (L3000015, Thermo Fisher, USA) was mixed with an equal volume of diluted plasmid DNA from each experimental group and allowed to incubate at room temperature (RT) for 15 min. For lentiviral transduction, HEK293T cells were seeded in six-well plates (TCP011006, Jet BIOFIL, China) and infected with lentiviral particles carrying the pLKO.1-IDO1 short hairpin RNA (shRNA) expression construct, in accordance with the experimental grouping scheme. Subsequently, the MC38 cells were transduced with the lentivirus, and stable cell lines were established through puromycin selection (10 µg/mL, HY-B1743A, MedChem Express) for 7–14 days post-infection. A very effective knockdown cell line was identified as MC38-sh-IDO1, and the controls were named MC38-sh-NC. After transduction, 2 µM ferrostatin-1 (HY-100579, MedChemExpress, USA) was added to the cells. The si-DOI1 sequence is provided below: IDO1 shRNA-1 forward, 5'-ACATTCATAGATGATAACGCTT TCAAGAGAAGCGTTATCATCTATGAATGT-3', and reverse, 5'-CGTTATCATCTATGAATGTAAAAGTT CTCTTTACATTCATAGATGATAACG-3'. IDO1 shRNA -2 forward, 5'-AGTATTACATTCATAGATGATTTCA AGAGAATCATCTATGAATGTAATACT-3'; and reverse, 5'-CATCTATGAATGTAATACTTTAAGTTCTCTAAA GTATTACATTCATAGATG-3'; IDO1 shRNA-3 forward, 5'-AGGAAAAAGAAGGTCAAACGGTTCAAGAGACC GTTTGACCTTCTTTTTCCT-3' and reverse, and 5'-GT TTGACCTTCTTTTTCCTGGAAGTTCTCTCCAGGAA AAAGAAGGTCAAAC-3'.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

RNA extraction was performed with the cell/tissue total RNA isolation kit V2 (RC112, Vazyme, China), adhering strictly to the manufacturer’s guidelines. Subsequently, first-strand cDNA synthesis was conducted using the HiScript lll first-strand cDNA synthesis kit (R312, Vazyme, China). RTqPCRs were performed in triplicate using the CFX96 Touch 1855195 (Bio-Rad, USA) with Taq Pro Universal SYBR qPCR Master Mix (Q712, Vazyme, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for normalization, and relative gene expression levels were calculated using the 2^-∆∆CT method. All RT-qPCR primers [Table 1] were custom designed and synthesized by Sangon Biotech (China).

Western blot

Cellular proteins were extracted using radioimmuno precipitation assay lysate (P0013B, Beyotime, China) supplemented with phenylmethylsulfonyl fluoride (ST506, Beyotime, China) on ice. Protein concentrations were quantified using a bicinchoninic acid assay kit (WB6501, NCM Biotech, China). Equal amounts of protein were resolved by 5–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (WB2001, NCM Biotech, China) and transferred onto a polyvinylidene fluoride membrane (IPVH00010, Millipore, USA). The membrane was blocked with 5% skim milk for 1 h at 25°C, followed by incubation with primary antibodies overnight at 4°C and subsequent probing with horse radish peroxidase (HRP)-conjugated secondary antibodies (1:10,000, Bioss, China) for 1 h at RT. Protein bands were visualized using a chemiluminescence substrate (P2100, NCM Biotech, China; 1:1 mixture of reagents A and B) and imaged with a JP-K6000 chemiluminescence imager (Jiapeng, Shanghai). Densitometric analysis was performed using ImageJ software (v1.53, NIH, USA). The primary antibodies included the following: IDO1 (1:2000, 13268-1-AP, Proteintech, China); GPX4 (1:2000, 67763-1-Ig, Proteintech, China); SLC7A11 (1:2000, 26864-1-AP, Proteintech, China); Cyclooxygenase-2 (COX-2) (1:4000, 66351-1-Ig, Proteintech, China); Acyl-CoA synthetase long-chain family member 4 (1:6000, 22401-1-AP, Proteintech, China); nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 1 (1:2500, 17772-1-AP, Proteintech, China); nuclear factor E2-related factor 2 (1:6000, 16396-1- AP, Proteintech, China); ferritin heavy polypeptide 1 (1:1000, ab65080, Abcam, Britain); and glyceraldehyde-3-phosphate dehydrogenase (1:1000, bsm-33033M, Bioss, China). The secondary antibody consisted for the following: goat anti-rabbit immunoglobulin G (IgG) H&L/HRP (1:10000, bs-0295G-HRP, Bioss, China) and goat anti-mouse IgG H&L/HRP (1:10000, bs-0296G-HRP, Bioss, China).

Enzyme-linked immunosorbent assay (ELISA)

Stably transfected MC38 cells were inoculated in six-well plates at 1 × 10⁵ cells/well and treated with 30 µmol/L Erastin or 6 µmol/L RSL3 at 37°C for 48 h. The cell cultures of each group were aspirated through centrifugation at 1000 g for 20 min, and the supernatant was collected. The assay was performed in accordance with the protocols of the manufacturers of the GSH detection kit (HNY-EL-GSH-48T, HnyBio, China) and malondialdehyde (MDA) detection kit (HNY-EL-MDA-48T, HnyBio, China). Optical density value of each well was measured sequentially at 450 nm using RT-6000 enzyme microplate reader (Rayto, USA).

Measurement of ROS generation, NADPH, and ferrous ion (Fe²⁺)

Cell viability assay

Stably transfected MC38 cells (2,000 cells/well) were seeded in 96-well plates and treated with either 30 µM Erastin or 6 µM RSL3 in complete medium (10% FBS). Following incubation at 37°C for 24, 48, or 72 h, cell viability was assessed by adding 10 µL cell counting kit-8 (CCK-8) reagent (BA00208, Bioss, China) per well, followed by 100 µL fresh medium. After 4 h of incubation, absorbance at 450 nm was measured using an RT-6000 enzyme microplate reader (Rayto, USA).

Cell invasion assay (Transwell)

Stably transfected MC38 cells in the log-phase growth were trypsinized and resuspended in serum-free medium at 1 × 10⁵ cells/mL. A total of 100 µL cell suspension was added to the Matrigel-coated upper chamber (Corning, USA), and the lower chamber contained DMEM with 10% FBS supplemented with either 30 µM Erastin or 6 µM RSL3 (n = 3 replicates/group). After 48 h incubation, non-invaded cells were removed from the upper chamber. Invaded cells were fixed with 4% paraformaldehyde (30 min), stained with 0.1% crystal violet (C0121, Beyotime, China; 20 min), and rinsed with PBS. Membranes were air dried and imaged using an inverted microscope (BZ-H4XD, KeenS, Japan). Invasion was quantified by counting stained cells in 5 random fields/well using ImageJ.

Cell migration assay (wound healing)

Stably transfected MC38 cells were seeded in six-well plates until >90% confluency. A sterile 200 µL pipette tip was used to create uniform scratches (aligned with premarked grid lines). Cells were treated with 30 µM Erastin or 6 µM RSL3 for 48 h. Scratch width was imaged at 0 and 48 h using the same microscope. Migration distance was processed through ImageJ.

Immunofluorescence

Cells (1 × 10⁶/well) were seeded in six-well plates and grouped for subsequent treatment. After incubation, the culture medium was removed, and the cells were washed thrice with PBS. Fixation was performed using 1 mL 4% paraformaldehyde on a shaker for 20 min. Following fixation, the cells were rinsed again with PBS thrice and then permeabilized with 1 mL 0.25% Triton-X100 for 20 min under gentle shaking. After another triple PBS wash, the cells were blocked with 1 ml goat serum for 30 min. The blocking solution was discarded, and cells were incubated overnight at 4°C with 1 mL xCT primary antibody xCT (1:200, 26864-1-AP, Proteintech, China). The next day, the antibody was removed, and the cells were washed thrice with Tris-buffered saline with Tween 20 (TBST) (5 min each). Then, 1 mL Alexa Fluor 488-conjugated Goat Anti-Rabbit IgG (1:200, A-11008, Invitrogen, USA) was added and incubated for 1 h at RT in the dark. After discarding the secondary antibody, the cells were washed again thrice with TBST. Finally, the samples were mounted using Fluoroshield^™luoro4',6-diamidino-2-phenylindole and observed under a fluorescence microscope (Keens-bz-h4xd, KeenS, Japan). Fluorescence intensity of xCT was analyzed using ImageJ software.

ROS level was detected by DCFH-DA fluorescent probe

Cells (1 × 10⁶ cells/mL) were seeded into 6 cm culture dishes. On reaching 80–90% confluence, the culture medium was removed, and the cells were incubated with an appropriate volume of diluted DCFH-DA working solution (HY-D0940, MedChemExpress, USA) at 37°C for 20 min. During incubation, the dishes were gently inverted every 5 min to promote uniform probe contact. After incubation, the probe solution was discarded, and the cells were rinsed thrice with PBS. Following removal of the supernatant, fresh PBS was added, and the cells were immediately observed under a fluorescence microscope (Keens-bz-h4xd, KeenS, Japan).

Statistics

All experiments were repeated at least thrice independently, and all data are expressed as mean ± standard deviation (mean ± SD). Gray-scale analysis of Western blot strips was performed using ImageJ software. The data were analyzed in the Statistical Package for the Social Sciences (SPSS) 22.0, and the representative graphs were created using GraphPad Prism 8. Comparisons between groups were conducted using t-test and one-way analysis of variance (ANOVA). When the group number was 2, we used t-test. When the group number was more than 2, we used one-way ANOVA. For multiple comparisons, one-way ANOVA followed by Tukey’s post hoc test was used. A statistical significance level of P < 0.05 was used to determine significant differences.

RSL3/Erastin treatment promotes IDO1 expression in CRC cell lines

Based on species identification and mycoplasma test results, CT-26, MC-38, HT-29, and NCM460 PCR results for mycoplasma were negative (S2). Compared with the mock group, the Erastin and RSL3 groups showed higher mRNA and protein expression of IDO1 in MC38, CT26, and HT29 cells (P < 0.001), with no significant difference in the expression of NCM460 cells [Figure 1a]. After the treatment with Erastin, compared with that in the MOCK group, the protein expression of IDO1 was elevated in MC38, CT26, and HT29 cells in the Erastin group, and no significant difference was observed in NCM460 cells. After the treatment with RSL3, compared with that in the MOCK group, the protein expression of IDO1 also increased in MC38, CT26, and HT29 cells in the RSL3 group, with no evident difference in NCM460 cells. TheMC38 cell lines treated with Erastin displayed the most significant alterations of IDO1 expression at the mRNA and protein levels. In addition, CT26 cell lines treated with RSL3 exhibited the most significant alterations of IDO1 expression in mRNA levels (P < 0.05) [Figure 1b]. The MC38 cell line was selected as a target for IDO1 knockdown.

Close

Figure 1: Effect of Erastin and RSL3 on IDO1 expression in CRC cells and normal colonic epithelial cell lines. (a) RT-qPCR was used to detect the mRNA expression of IDO1 in MC38, CT26, HT29, and NCM460 cells. (b) Western blot analysis was performed to analyze the protein levels of IDO1 in MC38, CT26, HT29, and NCM460 cells. The mRNA and protein expressions of the MOCK group were normalized to 1. Data is reported as mean ± SD with three replicates. n = 3. ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001, ns: No significance. IDO1: Immune checkpoint indoleamine 2,3-dioxygenase 1, CRC: Colorectal cancer, RT-qPCR: Reverse transcription quantitative polymerase chain reaction, SD: Standard deviation, mRNA: Messenger RNA.

Export to PPT

IDO1 knockdown promotes the progression of ferroptosis

As shown in Figure 2a and b, validating the effect of IDO1 knockdown in MC38 cell line through RT-qPCR and Western blot, we successfully constructed the IDO1 knockdown MC38 cell line (MC38-sh-IDO1) and the corresponding control MC38 cell line (MC38-sh-NC) (P < 0.01). As revealed in Figure 2c and d, compared with those in the sh-NC group, the mRNA and protein expressions of GPX4, SLC7A11, NRF2, and FTH1 were significantly lower in the sh-IDO1 group, and those of COX-2, ACSL4, and NOX1 were significantly higher (P < 0.05).

Close

Figure 2: Construction of IDO1 knockdown in MC38 cell line and validation of expression levels of ferroptosis-related genes. (a) Western blot was used to detect IDO1 knockdown at the protein level. (b) RT-qPCR was used to detect IDO1 knockdown at the mRNA level. (c) Western blot analysis was performed to analyze the protein levels of GPX4, SLC7A11, COX-2, ACSL4, NOX1, NRF2, and FTH1 in MC38-sh-IDO1 and MC38-sh-NC. (d) RT-qPCR was performed to analyze the mRNA levels of GPX4, SLC7A11, COX-2, ACSL4, NOX1, NRF2, and FTH1 in MC38-sh-IDO1 and MC38-sh-NC. Data is reported as mean ± SD with three replicates. n = 3. ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶ P < 0.001. IDO1: Immune checkpoint indoleamine 2, 3-dioxygenase 1, GPX4: Glutathione peroxidase 4, SLC7A11: Solute carrier family 7 member 11, COX-2: Cyclooxygenase-2, ACSL4: Acyl-CoA synthetase long-chain family member 4, NOX1: NADPH oxidase 1, NRF2: Nuclear factor E2-related factor 2, FTH1: Ferritin heavy polypeptide 1, RT-qPCR: Reverse transcription quantitative polymerase chain reaction, SD: Standard deviation, mRNA: Messenger RNA, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, sh-NC: short hairpin-negative control.

Export to PPT

Combined IDO1 knockdown and RSL3/Erastin synergistically suppress CRC cell function

As displayed in Figure 3a, the cell invasion ability was significantly reduced in the sh-IDO1+Erastin and sh-IDO1+RSL3 groups compared with the sh-NC+Erastin and sh-NC+RSL3 groups (P < 0.001). Figure 3b and c reveals the significantly reduced cell migration ability in the sh-IDO1+Erastin and sh-IDO1+RSL3 groups compared with the sh-NC+Erastin and sh-NC+RSL3 groups (P < 0.001). As shown in Figure 3d, the cell proliferation ability was significantly reduced in the sh-IDO1+Erastin and sh-IDO1+RSL3 groups compared with the sh-NC+Erastin and sh-NC+RSL3 groups (P < 0.001).

Close

Figure 3: Effects of RSL3/Erastin on the function of MC38 cells with stable knockdown of IDO1. (a) Transwell assay was performed to evaluate the effect of RSL3/Erastin on the invasion ability of IDO1 knockdown MC38 cells. Scale bar: 150 µm ×100. (b and c) Wound-healing assay was conducted to assess the effect of RSL3/Erastin on the migration ability of IDO1 knockdown MC38 cells. Scale bar: 300 µm ×40. (d) CCK-8 assay was implemented to detect the effects of RSL3/Erastin on the proliferation ability of IDO1 knockdown MC38 cells. Data are reported as mean ± SD with three replicates. n = 3. ^✶✶✶P < 0.001. IDO1: Immune checkpoint indoleamine 2,3-dioxygenase 1, CCK-8: Cell counting kit-8, SD: Standard deviation, sh-NC: short hairpin-negative control, OD: Optical density.

Export to PPT

Combined IDO1 knockdown and RSL3/Erastin synergistically triggers ferroptosis in CRC cell

As shown in Figure 4a-d, in the sh-IDO1+Erastin group, a marked reduction in GSH and NADPH levels was observed, while MDA and Fe2⁺ levels showed a significant increase relative to the sh-NC+Erastin group (P < 0.001). In addition, compared with those in the sh-NC+RSL3 group, the GSH levels were significantly lower, and the MDA levels were significantly higher in the sh-IDO1+RSL3 group (P < 0.001). Figure 4e illustrates that the level of ROS in the sh-IDO1+Erastin group was the highest among the four groups. Compared with those in the sh-NC+Erastin and sh-NC+RSL3 groups, the levels of ROS in the sh-IDO1+Erastin and sh-IDO1+RSL3 were significantly elevated.

Close

Figure 4: Effects of RSL3/Erastin on the ferroptosis indicator of MC38 cells with stable knockdown of IDO1. ELISA was performed to analyze the levels of (a) GSH and (b) MDA. Colorimetric methods were performed to detect the levels of (c) Fe²⁺ and (d) NADPH. (e) Flow cytometry was conducted to detect the level of ROS. Data is reported as mean ± SD with three replicates. n = 3. ^✶✶✶P < 0.001. IDO1: Immune checkpoint indoleamine 2,3-dioxygenase 1, ELISA: Enzyme-linked immunosorbent assay, GSH: Glutathione, MDA: Malondialdehyde, NADPH: Nicotinamide adenine dinucleotide phosphate, ROS: Reactive oxygen species, Fe²⁺: Ferrous ion, SD: Standard deviation, sh-NC: short hairpin-negative control, DCFH-DA: 2'−7'-dichlorodihydrofluorescein diacetate.

Export to PPT

Knockdown of IDO1 upregulates Fe²⁺ and ROS levels and downregulates GSH levels

As shown in Figure 5a-c, the levels of ROS in the MC38-sh-IDO1 and MC38-sh-NC groups were detected using immunofluorescence and DCFH-DA fluorescent probe, those of GSH were detected by ELISA, and those of Fe²⁺ were detected through colorimetric assay. The results show the significantly higher levels of ROS (P < 0.05) and Fe²⁺ (P < 0.001) and significantly lower level of GSH in the sh-IDO1 group than in the sh-NC group (P < 0.001).

Close

Figure 5: Detecting levels of indicators associated with ferroptosis. (a) Immunofluorescence was used to detect the intracellular ROS levels. Scale bar: 100 µm. (b) ELISA was performed to detect the GSH levels. (c) Colorimetric assay was conducted to detect the Fe²⁺ levels. Data are reported as mean ± SD with three replicates. n = 3. ^✶P < 0.05, ^✶✶✶P < 0.001. IDO1: Immune checkpoint indoleamine 2,3-dioxygenase 1, ROS: Reactive oxygen species, ELISA: Enzyme-linked immunosorbent assay, GSH: Glutathione, Fe²⁺: Ferrous ion, SD: Standard deviation, sh-NC: short hairpin-negative control.

Export to PPT

Ferroptosis inhibitors mitigate the progression of ferroptosis due to IDO1 knockdown

As shown in Figure 6a, through the addition of ferrostatin-1 to MC38-sh-IDO1, the cell proliferation ability was detected via CCK-8. IDO1 knockdown inhibited the proliferation of MC38 cells, and ferrostatin-1 treatment promoted the proliferation of MC38-sh-IDO1 cells (P < 0.001). As presented in Figure 6b and c, compared with that in the MC38-sh-NC group, the expression level of xCT in the MC38-sh-IDO1 group was significantly decreased, and that of xCT in the MC38-sh-IDO1+Ferrostatin 1 group was significantly increased. Compared with that in MC38-sh-NC, the expression of xCT in MC38-sh-IDO1+Ferrostatin-1 group decreased. This finding indicates the important role of sh-IDO1 (P < 0.05). The levels of ROS in cells were detected through immunofluorescence [Figure 6d and 6e]. Compared with the MC38-sh-NC + Ferrostatin 1 group, the MC38-sh-IDO1 + Ferrostatin-1 group exhibited an increased ROS level. Compared with that in the MC38-sh-NC group, the ROS level in the MC38-sh-IDO1+Ferrostatin-1 group increased (P < 0.05).

Close

Figure 6: Effect of Ferrostatin-1 on CRC cells after IDO1 knockdown. (a) CCK-8 was used to detect cell proliferative ability. (b and c) Immunofluorescence was utilized to detect the xCT expression level. Scale bar: 100 µm. (d and e) Immunofluorescence was applied to detect intracellular ROS levels. Scale bar: 100 µm. Data are reported as mean applied to detect intracellular n = 3. ^✶✶✶P < 0.001. IDO1: Immune checkpoint indoleamine 2, 3-dioxygenase 1, CCK-8: Cell counting kit-8, xCT: Solute carrier family 7 member 11, ROS: Reactive oxygen species, SD: Standard deviation, sh-NC: short hairpin-negative control, DAPI: 4’,6-diamidino-2-phenylindole.

Export to PPT