Translate this page into:
Combine immune checkpoint indoleamine 2,3-dioxygenase 1 knockdown with ferroptosis inducer Erastin/RSL3 accelerates colorectal cancer cell ferroptosis
-
Received: ,
Accepted: ,
How to cite this article: Li F, Xu T, Ling Y, Xu J, Zhang X, Sun S. Combine immune checkpoint indoleamine 2,3-dioxygenase 1 knockdown with ferroptosis inducer Erastin/RSL3 accelerates colorectal cancer cell ferroptosis. CytoJournal. 2026;23:32. doi: 10.25259/Cytojournal_262_2024
Abstract
Objective:
Colorectal cancer (CRC) is a malignancy known for its aggressive behavior and notable mortality burden. Indoleamine 2,3-dioxygenase 1 (IDO1), an immune checkpoint molecule, is markedly upregulated in CRC, and it has been implicated in the regulation of key components of the ferroptosis pathway. This study aimed to elucidate the regulatory interaction between IDO1 and ferroptosis and assess the potential therapeutic effect of combined IDO1 inhibition with ferroptosis inducers Erastin and RSL3 in CRC.
Material and Methods:
Three CRC cell lines (CT26, MC38, and HT-29) and one normal colon epithelial cell line (NCM460) were treated with ferroptosis inducers to evaluate the changes in IDO1 expression through reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blotting. MC38 cells with stable IDO1 knockdown were generated through lentiviral transduction. The expressions of ferroptosis-related genes following IDO1 silencing were assessed through RT-qPCR and Western blot. The antitumor efficacy of combined IDO1 knockdown and Erastin/RSL3 treatment was evaluated through cell counting kit-8, Transwell migration, and wound-healing assays. Enzyme-linked immunosorbent assay was employed to quantify intracellular levels of glutathione (GSH) and malondialdehyde (MDA). Reactive oxygen species (ROS) levels were measured via flow cytometry, and ferrous ion (Fe2+)and nicotinamide adenine dinucleotide phosphate (NADPH) concentrations were determined through colorimetric analysis.
Results:
Treatment with Erastin and RSL3 upregulated IDO1 expression in CRC cells. Silencing of IDO1 in MC38 cells resulted in increased expressions of cyclooxygenase-2, acyl-CoA synthetase long chain family member 4, and NADPH oxidase 1, alongside decreased expression of GSH peroxidase 4, solute carrier family 7 member 11, ferritin heavy chain 1, and nuclear factor E2-related factor 2. The combination of IDO1 knockdown with Erastin/RSL3 treatment significantly reduced the proliferation, invasion, and migration of MC38 cells (P < 0.001). This combined treatment also elevated intracellular MDA, ROS, and Fe2+ levels while lowering GSH and NADPH levels.
Conclusion:
Combination therapy with IDO1 inhibitor and ferroptosis inducer may be an effective way to improve treatment efficacy in CRC.
Keywords
3-dioxygenase 1
Colorectal
Ferroptosis
Indoleamine 2
INTRODUCTION
Colorectal cancer (CRC) remains a major challenge to global health. Recent data indicate that CRC is the third most prevalent cancer diagnosis globally and the second highest contributor to cancer mortality (American Cancer Society, 2022).[1] The rising global incidence of CRC underscores its growing threat to public health. Consequently, the development of innovative and effective therapeutic approaches remains a critical and pressing need.
Metabolic reprogramming refers to an indirect response to tumor cell proliferation and survival signals.[2,3] During tumor cell progression from precancerous tissue to local infiltration to metastasis, the metabolic phenotypes of stromal and immune cells in the tumor microenvironment are altered.[4] Tryptophan, a vital amino acid, plays a crucial role in supporting cellular growth and metabolic processes.[5] This compound is also closely linked to disruptions in immune system function.[6] Abnormal tryptophan metabolism occurs in most tumors, with tumor cells commonly overexpressing tryptophan catabolic enzymes, which leads to the overconsumption of tryptophan.[7] Approximately 95% of tryptophan undergoes oxidative metabolism through the kynurenine pathway (KP), which yields metabolites, such as kynurenine (Kyn), 3-hydroxy-kynurenine (3-HK), 3-hydroxyanthranilic acid (3-HAA), quinolinic acid, and related compounds.[8] Indoleamine 2,3-dioxygenase 1 (IDO1) serves as a primary rate-limiting enzyme in extrahepatic tissues, and it drives the breakdown of tryptophan through the KP.[9] IDO1 is highly expressed in CRC tissues.[10] IDO1 achieves immune escape from tumors mainly by decreasing the activity of CD8+ T cells while enhancing the function of regulatory T cells.[11] A high expression of IDO1 affects the overall survival of CRC patients and leads to poor prognosis.[12,13] A small number of inhibitors targeting IDO1, such as indoximod,[14] epacadostat,[15] and navoximod,[16] have reached the clinical stage.
Ferroptosis represents a newly identified form of regulated cell death, and it is distinguished by excessive intracellular iron levels, lipid peroxidation, and the buildup of reactive oxygen species (ROS).[17] The growth of cancer cells can be inhibited by affecting the expressions of ferroptosis-related genes; thus, the regulation of ferroptosis has great potential in tumor therapy.[18,19] Erastin and RSL3 are common inducers of ferroptosis, and they produce excess free radicals through various pathways and increase the accumulation of intracellular iron, which leads to oxidative damage and cell death. The cell surface cystine/glutamate antiporter (System Xc-) promotes intracellular cystine uptake and participates in the synthesis of glutathione (GSH). Cystine serves as an important precursor for GSH synthesis, and its deficiency leads to reduced levels of GSH and ROS accumulation.[20] Erastin suppresses System Xc- activity, which leads to intracellular GSH depletion and accumulation of ROS. Glutathione peroxidase 4 (GPX4) is an important target for triggering the ferroptosis pathway that kills cancer cells.[21,22] RSL3 is one of the representative drugs of GPX4 inhibitors. In biological membranes, GPX4 acts as an antioxidant by reducing lipid hydroperoxides. GSH requires a sufficient level of GPX4 for it to be a reductant in the local peroxidase reaction cycle. RSL3 binds with a high affinity to the GPX4 active site and irreversibly inactivates GPX4.[23] Although Erastin and RSL3 are promising antitumor agents, their individual application is insufficient to completely limit tumor growth in the body.
Emerging research indicates the regulatory role of IDO1 in ferroptosis mechanisms. On the one hand, a high level of IDO1 expression in tumor cells deregulates the oxidative stress state and prevents ferroptosis by upregulating tryptophan metabolites. IDO1 regulates the catabolism of tryptophan to Kyn and kynurenic acid and further metabolizes them to 3-HK and 3-HAA, respectively, which display strong ROS scavenging capabilities.[24] Tryptophan is also catabolized by interleukin-4-induced protein 1 (IL-4I1) to indole-3-pyruvate, which has strong anti-ferroptosis activity and suppresses ferroptosis by activating the aryl hydrocarbon receptor ligand pathway.[25] On the other hand, high level of IDO1 expression in tumors upregulates tryptophan catabolism to suppress ferroptosis by upregulating solute carrier family 7 member 11 (SLC7A11) expression. Excessive catabolism of tryptophan in tumors can suppress ferroptosis by activating the intracellular stress pathway to upregulate SLC7A11 expression and promote GSH synthesis. In addition, Kyn competes with cysteine for binding to the SLC7A11 transporter, which results in a state of “pseudo-starvation” of cysteine; this condition suppresses ferroptosis by upregulating SLC7A11 expression through the general control non-repressible 2-activating transcription factor 4 pathway.[26] The tryptophan catabolic enzymes IDO2,[27] tryptophan-2,3-dioxygenase (TDO),[28] and IL-4I1[29] show high expressions and may suppress tumor ferroptosis in CRC, which is the reason why IDO1 inhibitors do not exert superior therapeutic effects.
Based on the relationship between IDO1 and ferroptosis, knockdown of IDO1 may reverse ferroptosis resistance in CRC cells. In this study, Erastin and RSL3 were used to induce ferroptosis in three CRC cell lines and one normal colonic epithelial cell line to explore whether IDO1 expression would be affected. One CRC cell line sensitive to Erastin or RSL3 was subjected to IDO1 knockdown to determine alterations in the ferroptosis-related pathways. CRC cell lines with IDO1 knockdown were administered with Erastin or RSL3 to determine the effect of their combined treatment on CRC cell function and modifications in the levels of ferroptosis markers.
MATERIAL AND METHODS
Cell culture and chemicals
The mouse colorectal carcinoma cell lines CT-26 (CL-0025) and MC-38 (CL-0605), along with the human colorectal carcinoma cell line HT-29 (CL-0138), were acquired from ProCell Life Science and Technology Co., Ltd. (Wuhan, China). In addition, the non-tumorigenic colonic epithelial cell line NCM460 (CL-0359) was procured from the same supplier. All cell lines were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (C11965500bt, Gibco, USA) containing with 10% heat-inactivated fetal bovine serum (FBS) (FSP500, Excell Bio, China) and antibiotic–antimycotic solution (100 U/mL penicillin and 100 µg/mL streptomycin, Q6532, MACKLIN, China). We maintained the cells at 37°C in a humidified incubator (Boxun biotechnology, Shanghai, China) containing 5% carbon dioxide. RSL3 (HY-100218A) and Erastin (HY-15763) were obtained from MedChem Express (USA). After 20 µmol/L Erastin or 4 µmol/L RSL3 treatment of the four cell lines for 24 h, cells were collected for messenger RNA (mRNA) and protein extraction. We sent the above cell lines to Xiamen Immocell Biotechnology Co. Ltd., and species identification and mycoplasma detection were performed.
Gene silencing and transduction
The National Center for Biotechnology Information database provided the IDO1 gene sequence [Supplementary Figure S1]. Gene-specific small interfering (si) RNAs against IDO1 and a scrambled negative control (si-NC) were commercially sourced from Suzhou Gemma Genetics (China). For transfection, 250 µL Lipofectamine 3000 (L3000015, Thermo Fisher, USA) was mixed with an equal volume of diluted plasmid DNA from each experimental group and allowed to incubate at room temperature (RT) for 15 min. For lentiviral transduction, HEK293T cells were seeded in six-well plates (TCP011006, Jet BIOFIL, China) and infected with lentiviral particles carrying the pLKO.1-IDO1 short hairpin RNA (shRNA) expression construct, in accordance with the experimental grouping scheme. Subsequently, the MC38 cells were transduced with the lentivirus, and stable cell lines were established through puromycin selection (10 µg/mL, HY-B1743A, MedChem Express) for 7–14 days post-infection. A very effective knockdown cell line was identified as MC38-sh-IDO1, and the controls were named MC38-sh-NC. After transduction, 2 µM ferrostatin-1 (HY-100579, MedChemExpress, USA) was added to the cells. The si-DOI1 sequence is provided below: IDO1 shRNA-1 forward, 5'-ACATTCATAGATGATAACGCTT TCAAGAGAAGCGTTATCATCTATGAATGT-3', and reverse, 5'-CGTTATCATCTATGAATGTAAAAGTT CTCTTTACATTCATAGATGATAACG-3'. IDO1 shRNA -2 forward, 5'-AGTATTACATTCATAGATGATTTCA AGAGAATCATCTATGAATGTAATACT-3'; and reverse, 5'-CATCTATGAATGTAATACTTTAAGTTCTCTAAA GTATTACATTCATAGATG-3'; IDO1 shRNA-3 forward, 5'-AGGAAAAAGAAGGTCAAACGGTTCAAGAGACC GTTTGACCTTCTTTTTCCT-3' and reverse, and 5'-GT TTGACCTTCTTTTTCCTGGAAGTTCTCTCCAGGAA AAAGAAGGTCAAAC-3'.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
RNA extraction was performed with the cell/tissue total RNA isolation kit V2 (RC112, Vazyme, China), adhering strictly to the manufacturer’s guidelines. Subsequently, first-strand cDNA synthesis was conducted using the HiScript lll first-strand cDNA synthesis kit (R312, Vazyme, China). RTqPCRs were performed in triplicate using the CFX96 Touch 1855195 (Bio-Rad, USA) with Taq Pro Universal SYBR qPCR Master Mix (Q712, Vazyme, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for normalization, and relative gene expression levels were calculated using the 2-∆∆CT method. All RT-qPCR primers [Table 1] were custom designed and synthesized by Sangon Biotech (China).
| Primers | Sequence (5'→3') |
|---|---|
| Human IDO1 | |
| Forward | TTCAGTGCTTTGACGTCCTG |
| Reverse | GTCTTATTCTCCTTTGGCTGC |
| IDO1 Mouse | |
| Forward | CTCCGCATATATCTGTCTGG |
| Reverse | GAGGAATTCTGCAGGAGATTC |
| GPX4 Mouse | |
| Forward | TCCATGCACGAATTCTCAGC |
| Reverse | TTGATTACTTCCTGGCTCCTG |
| SLC7A11 Mouse | |
| Forward | TATTCTACGTCGCATCTCGAG |
| Reverse | AGATAAATCAGTCCTGCGACTG |
| COX-2 Mouse | |
| Forward | GCAAAGGCCTCCATTGACC |
| Reverse | TAGCATCTGGACGAGGTTTTTC |
| ACSL4 Mouse | |
| Forward | TTCCTCCAAGTAGACCAACC |
| Reverse | CTTCCCTTCTTGATTTTGCTGG |
| NOX1 Mouse | |
| Forward | AATTCCCTGGAACAAGAGATGG |
| Reverse | CAGGCTTTTTGCCAAAGTCC |
| NRF2 Mouse | |
| Forward | ATGATGGACTTGGAGTTGC |
| Reverse | TCACACACTTTCTGCGTG |
| FTH1 Mouse | |
| Forward | ACTACTGGAACTGCACAAACTG |
| Reverse | TTAGCTCTCATCACCGTGTC |
| GAPDH Human | |
| Forward | CGCTAACATCAAATGGGGTG |
| Reverse | TGCCAGCCCCAGCGTCAAAG |
| GAPDH Mouse | |
| Forward | GTCAAGGCCGAGAATGGGAA |
| Reverse | CGGCCTCACCCCATTTGAT |
IDO1: Indoleamine 2,3-dioxygenase 1, GPX4: Glutathione peroxidase 4, SLC7A11: Solute carrier family 7 member 11, COX-2: Cyclooxygenase-2, ACSL4: Acyl-CoA synthetase long-chain family member 4, NOX1: Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 1, NRF2: Nuclear factor E2-related factor 2, FTH1: Ferritin heavy polypeptide 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine.
Western blot
Cellular proteins were extracted using radioimmuno precipitation assay lysate (P0013B, Beyotime, China) supplemented with phenylmethylsulfonyl fluoride (ST506, Beyotime, China) on ice. Protein concentrations were quantified using a bicinchoninic acid assay kit (WB6501, NCM Biotech, China). Equal amounts of protein were resolved by 5–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (WB2001, NCM Biotech, China) and transferred onto a polyvinylidene fluoride membrane (IPVH00010, Millipore, USA). The membrane was blocked with 5% skim milk for 1 h at 25°C, followed by incubation with primary antibodies overnight at 4°C and subsequent probing with horse radish peroxidase (HRP)-conjugated secondary antibodies (1:10,000, Bioss, China) for 1 h at RT. Protein bands were visualized using a chemiluminescence substrate (P2100, NCM Biotech, China; 1:1 mixture of reagents A and B) and imaged with a JP-K6000 chemiluminescence imager (Jiapeng, Shanghai). Densitometric analysis was performed using ImageJ software (v1.53, NIH, USA). The primary antibodies included the following: IDO1 (1:2000, 13268-1-AP, Proteintech, China); GPX4 (1:2000, 67763-1-Ig, Proteintech, China); SLC7A11 (1:2000, 26864-1-AP, Proteintech, China); Cyclooxygenase-2 (COX-2) (1:4000, 66351-1-Ig, Proteintech, China); Acyl-CoA synthetase long-chain family member 4 (1:6000, 22401-1-AP, Proteintech, China); nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 1 (1:2500, 17772-1-AP, Proteintech, China); nuclear factor E2-related factor 2 (1:6000, 16396-1- AP, Proteintech, China); ferritin heavy polypeptide 1 (1:1000, ab65080, Abcam, Britain); and glyceraldehyde-3-phosphate dehydrogenase (1:1000, bsm-33033M, Bioss, China). The secondary antibody consisted for the following: goat anti-rabbit immunoglobulin G (IgG) H&L/HRP (1:10000, bs-0295G-HRP, Bioss, China) and goat anti-mouse IgG H&L/HRP (1:10000, bs-0296G-HRP, Bioss, China).
Enzyme-linked immunosorbent assay (ELISA)
Stably transfected MC38 cells were inoculated in six-well plates at 1 × 105 cells/well and treated with 30 µmol/L Erastin or 6 µmol/L RSL3 at 37°C for 48 h. The cell cultures of each group were aspirated through centrifugation at 1000 g for 20 min, and the supernatant was collected. The assay was performed in accordance with the protocols of the manufacturers of the GSH detection kit (HNY-EL-GSH-48T, HnyBio, China) and malondialdehyde (MDA) detection kit (HNY-EL-MDA-48T, HnyBio, China). Optical density value of each well was measured sequentially at 450 nm using RT-6000 enzyme microplate reader (Rayto, USA).
Measurement of ROS generation, NADPH, and ferrous ion (Fe2+)
Intracellular ROS detection using 2'−7'-dichlorodihydrofluorescein diacetate (DCFH-DA) probe
The DCFH-DA fluorescent probe was used to measure intracellular ROS levels. Briefly, stably transfected MC38 cells (1 × 106 cells/well) were seeded in six-well plates and treated with 30 µmol/L Erastin or 6 µmol/L RSL3 for 48 h. The cells were then incubated with 10 µM DCFH-DA (diluted 1:1000 in serum-free medium) for 20 min at 37°C, washed with phosphate-buffered saline (PBS), and analyzed using an Attune NxT flow cytometer (Thermos Fisher, USA).
NADPH quantification
For NADPH measurement, cells were lysed in 200 µL NADP+/NADPH extraction buffer by gentle pipetting. The lysates were processed following the manufacturer’s instructions for the NADPH colorimetric assay kit, and the absorbance at 450 nm was recorded.
Total iron assay
Treated cells were collected through centrifugation, and the pellet was resuspended in 0.9 mL assay buffer per 1 × 106 cells. Cells were lysed through sonication (200 W, 3 s pulse, 10 s interval, and 30 cycles) and centrifuged at 10,000 ×g for 10 min at 4°C. The supernatant was collected, and total iron levels were determined through absorbance measurement at 593 nm after the preparation of the standard and working solutions as per the kit protocol.
Cell viability assay
Stably transfected MC38 cells (2,000 cells/well) were seeded in 96-well plates and treated with either 30 µM Erastin or 6 µM RSL3 in complete medium (10% FBS). Following incubation at 37°C for 24, 48, or 72 h, cell viability was assessed by adding 10 µL cell counting kit-8 (CCK-8) reagent (BA00208, Bioss, China) per well, followed by 100 µL fresh medium. After 4 h of incubation, absorbance at 450 nm was measured using an RT-6000 enzyme microplate reader (Rayto, USA).
Cell invasion assay (Transwell)
Stably transfected MC38 cells in the log-phase growth were trypsinized and resuspended in serum-free medium at 1 × 105 cells/mL. A total of 100 µL cell suspension was added to the Matrigel-coated upper chamber (Corning, USA), and the lower chamber contained DMEM with 10% FBS supplemented with either 30 µM Erastin or 6 µM RSL3 (n = 3 replicates/group). After 48 h incubation, non-invaded cells were removed from the upper chamber. Invaded cells were fixed with 4% paraformaldehyde (30 min), stained with 0.1% crystal violet (C0121, Beyotime, China; 20 min), and rinsed with PBS. Membranes were air dried and imaged using an inverted microscope (BZ-H4XD, KeenS, Japan). Invasion was quantified by counting stained cells in 5 random fields/well using ImageJ.
Cell migration assay (wound healing)
Stably transfected MC38 cells were seeded in six-well plates until >90% confluency. A sterile 200 µL pipette tip was used to create uniform scratches (aligned with premarked grid lines). Cells were treated with 30 µM Erastin or 6 µM RSL3 for 48 h. Scratch width was imaged at 0 and 48 h using the same microscope. Migration distance was processed through ImageJ.
Immunofluorescence
Cells (1 × 106/well) were seeded in six-well plates and grouped for subsequent treatment. After incubation, the culture medium was removed, and the cells were washed thrice with PBS. Fixation was performed using 1 mL 4% paraformaldehyde on a shaker for 20 min. Following fixation, the cells were rinsed again with PBS thrice and then permeabilized with 1 mL 0.25% Triton-X100 for 20 min under gentle shaking. After another triple PBS wash, the cells were blocked with 1 ml goat serum for 30 min. The blocking solution was discarded, and cells were incubated overnight at 4°C with 1 mL xCT primary antibody xCT (1:200, 26864-1-AP, Proteintech, China). The next day, the antibody was removed, and the cells were washed thrice with Tris-buffered saline with Tween 20 (TBST) (5 min each). Then, 1 mL Alexa Fluor 488-conjugated Goat Anti-Rabbit IgG (1:200, A-11008, Invitrogen, USA) was added and incubated for 1 h at RT in the dark. After discarding the secondary antibody, the cells were washed again thrice with TBST. Finally, the samples were mounted using Fluoroshield™luoro4',6-diamidino-2-phenylindole and observed under a fluorescence microscope (Keens-bz-h4xd, KeenS, Japan). Fluorescence intensity of xCT was analyzed using ImageJ software.
ROS level was detected by DCFH-DA fluorescent probe
Cells (1 × 106 cells/mL) were seeded into 6 cm culture dishes. On reaching 80–90% confluence, the culture medium was removed, and the cells were incubated with an appropriate volume of diluted DCFH-DA working solution (HY-D0940, MedChemExpress, USA) at 37°C for 20 min. During incubation, the dishes were gently inverted every 5 min to promote uniform probe contact. After incubation, the probe solution was discarded, and the cells were rinsed thrice with PBS. Following removal of the supernatant, fresh PBS was added, and the cells were immediately observed under a fluorescence microscope (Keens-bz-h4xd, KeenS, Japan).
Statistics
All experiments were repeated at least thrice independently, and all data are expressed as mean ± standard deviation (mean ± SD). Gray-scale analysis of Western blot strips was performed using ImageJ software. The data were analyzed in the Statistical Package for the Social Sciences (SPSS) 22.0, and the representative graphs were created using GraphPad Prism 8. Comparisons between groups were conducted using t-test and one-way analysis of variance (ANOVA). When the group number was 2, we used t-test. When the group number was more than 2, we used one-way ANOVA. For multiple comparisons, one-way ANOVA followed by Tukey’s post hoc test was used. A statistical significance level of P < 0.05 was used to determine significant differences.
RESULTS
RSL3/Erastin treatment promotes IDO1 expression in CRC cell lines
Based on species identification and mycoplasma test results, CT-26, MC-38, HT-29, and NCM460 PCR results for mycoplasma were negative (S2). Compared with the mock group, the Erastin and RSL3 groups showed higher mRNA and protein expression of IDO1 in MC38, CT26, and HT29 cells (P < 0.001), with no significant difference in the expression of NCM460 cells [Figure 1a]. After the treatment with Erastin, compared with that in the MOCK group, the protein expression of IDO1 was elevated in MC38, CT26, and HT29 cells in the Erastin group, and no significant difference was observed in NCM460 cells. After the treatment with RSL3, compared with that in the MOCK group, the protein expression of IDO1 also increased in MC38, CT26, and HT29 cells in the RSL3 group, with no evident difference in NCM460 cells. TheMC38 cell lines treated with Erastin displayed the most significant alterations of IDO1 expression at the mRNA and protein levels. In addition, CT26 cell lines treated with RSL3 exhibited the most significant alterations of IDO1 expression in mRNA levels (P < 0.05) [Figure 1b]. The MC38 cell line was selected as a target for IDO1 knockdown.

IDO1 knockdown promotes the progression of ferroptosis
As shown in Figure 2a and b, validating the effect of IDO1 knockdown in MC38 cell line through RT-qPCR and Western blot, we successfully constructed the IDO1 knockdown MC38 cell line (MC38-sh-IDO1) and the corresponding control MC38 cell line (MC38-sh-NC) (P < 0.01). As revealed in Figure 2c and d, compared with those in the sh-NC group, the mRNA and protein expressions of GPX4, SLC7A11, NRF2, and FTH1 were significantly lower in the sh-IDO1 group, and those of COX-2, ACSL4, and NOX1 were significantly higher (P < 0.05).

Combined IDO1 knockdown and RSL3/Erastin synergistically suppress CRC cell function
As displayed in Figure 3a, the cell invasion ability was significantly reduced in the sh-IDO1+Erastin and sh-IDO1+RSL3 groups compared with the sh-NC+Erastin and sh-NC+RSL3 groups (P < 0.001). Figure 3b and c reveals the significantly reduced cell migration ability in the sh-IDO1+Erastin and sh-IDO1+RSL3 groups compared with the sh-NC+Erastin and sh-NC+RSL3 groups (P < 0.001). As shown in Figure 3d, the cell proliferation ability was significantly reduced in the sh-IDO1+Erastin and sh-IDO1+RSL3 groups compared with the sh-NC+Erastin and sh-NC+RSL3 groups (P < 0.001).

Combined IDO1 knockdown and RSL3/Erastin synergistically triggers ferroptosis in CRC cell
As shown in Figure 4a-d, in the sh-IDO1+Erastin group, a marked reduction in GSH and NADPH levels was observed, while MDA and Fe2+ levels showed a significant increase relative to the sh-NC+Erastin group (P < 0.001). In addition, compared with those in the sh-NC+RSL3 group, the GSH levels were significantly lower, and the MDA levels were significantly higher in the sh-IDO1+RSL3 group (P < 0.001). Figure 4e illustrates that the level of ROS in the sh-IDO1+Erastin group was the highest among the four groups. Compared with those in the sh-NC+Erastin and sh-NC+RSL3 groups, the levels of ROS in the sh-IDO1+Erastin and sh-IDO1+RSL3 were significantly elevated.

Knockdown of IDO1 upregulates Fe2+ and ROS levels and downregulates GSH levels
As shown in Figure 5a-c, the levels of ROS in the MC38-sh-IDO1 and MC38-sh-NC groups were detected using immunofluorescence and DCFH-DA fluorescent probe, those of GSH were detected by ELISA, and those of Fe2+ were detected through colorimetric assay. The results show the significantly higher levels of ROS (P < 0.05) and Fe2+ (P < 0.001) and significantly lower level of GSH in the sh-IDO1 group than in the sh-NC group (P < 0.001).

Ferroptosis inhibitors mitigate the progression of ferroptosis due to IDO1 knockdown
As shown in Figure 6a, through the addition of ferrostatin-1 to MC38-sh-IDO1, the cell proliferation ability was detected via CCK-8. IDO1 knockdown inhibited the proliferation of MC38 cells, and ferrostatin-1 treatment promoted the proliferation of MC38-sh-IDO1 cells (P < 0.001). As presented in Figure 6b and c, compared with that in the MC38-sh-NC group, the expression level of xCT in the MC38-sh-IDO1 group was significantly decreased, and that of xCT in the MC38-sh-IDO1+Ferrostatin 1 group was significantly increased. Compared with that in MC38-sh-NC, the expression of xCT in MC38-sh-IDO1+Ferrostatin-1 group decreased. This finding indicates the important role of sh-IDO1 (P < 0.05). The levels of ROS in cells were detected through immunofluorescence [Figure 6d and 6e]. Compared with the MC38-sh-NC + Ferrostatin 1 group, the MC38-sh-IDO1 + Ferrostatin-1 group exhibited an increased ROS level. Compared with that in the MC38-sh-NC group, the ROS level in the MC38-sh-IDO1+Ferrostatin-1 group increased (P < 0.05).

DISCUSSION
The interplay between ferroptosis and immune checkpoints pathways offers promising insights into novel therapeutic strategies. Notably, immune checkpoint inhibitors (ICIs), which are widely applied in cancer therapy, enhance lipid peroxidation and facilitate ferroptotic cell death. This effect is mediated by CD8+ T cells activated during immunotherapy, which secrete interferon-gamma (IFN-γ). IFN-γ suppresses the expression of SLC3A2 and SLC7A11, which impairs the cell’s antioxidant defenses and thereby induces ferroptosis.[30] On the other hand, tumor ferroptosis increases immunogenicity and may enhance the therapeutic efficacy of ICIs.[31] During ferroptosis, tumor cells can enhance their immunogenicity through the release of damage-associated molecular patterns, lipid metabolites, and chemokines.[32] These tumor-derived antigens are subsequently processed by antigen-presenting cells and presented to cytotoxic T-lymphocytes (CTLs), which eliminate tumor cells through perforin/granzyme or Fas-dependent mechanisms. Ferroptosis-driven immunogenicity boosts CTL infiltration, which improves the therapeutic response to PD-1 inhibitors.[33]
IDO is frequently overexpressed in various tumor types, including CRC,[34] esophageal cancer,[35] breast cancer,[36] gastric cancer,[37] and lung cancer.[38] This enzyme acts as an immunosuppressive molecule that facilitates immune escape and contributes to tumor cell proliferation and migration. As the primary extrahepatic rate-limiting enzyme, IDO1 drives tryptophan degradation through the KP.[8] Tryptophan depletion weakens humoral immunity, and the accumulation of Kyn fosters an immune-tolerant environment.[39]
Excessive tryptophan catabolism enhances tumor-mediated immunosuppression. Given its role as a major tryptophancatabolizing enzyme, the development of IDO1 inhibitors is crucial for improving immunotherapy outcomes. However, the results of a phase III clinical trial combining the IDO1 inhibitor epacadostat with the PD1 monoclonal antibody pembrolizumab for advanced melanoma,[40] along with the underwhelming performance of other IDO inhibitors in clinical trials,[41] highlight the need for alternative strategies to enhance the effectiveness of IDO1-targeted therapies.
As a newly characterized mode of regulated cell death, ferroptosis exhibits promising antitumor effects mediated by specific inducers.[42] In this study, we observed that ferroptosis inducers increased the expression of IDO1 in CRC cells. Higher response rates exerted by ICIs require the expression of more effector targets on the tumor.[43] We observed that combined IDO1 knockdown and RSL3/Erastin resulted in considerable upregulation of ROS and lipid peroxidation, consistent with the biological features of ROS, Fe2+aggregation, and GSH depletion during ferroptosis.[44] Erastin is the earliest identified specific inducer of ferroptosis, and it can directly suppress System Xc- activity and affect GSH synthesis.[21] RSL3 was discovered while screening for lethal small molecules targeting Ras.[45] Other drugs have been used clinically to induce ferroptosis. Sulfasalazine (SAS) is an anti-inflammatory drug used in rheumatoid arthritis. SAS specifically inhibits System Xc- and markedly inhibits lung cancer and breast cancer cell proliferation in vitro.[46] Sorafenib, a multikinase inhibitor, is widely used in clinical settings for the management of advanced renal cell carcinoma.[47] Cisplatin, on the other hand, exhibits a strong affinity for sulfhydryl-containing biomolecules and can directly interact with GSH, which leads to GSH depletion and the inactivation of GPX4.[48] These clinically applied drugs that cause ferroptosis in tumor cells suffer from poor bioavailability and insufficient targeting when applied alone. In this study, we constructed IDO1 knockdown CRC cell lines to mimic the effects of IDO1 inhibitors, with the accurate targeting of IDO1 inhibitors compensating for ferroptosis. We observed that combined IDO1 inhibition and Erastin/RSL3 exerted a notable suppression of CRC cell growth and significantly accelerated the progression of ferroptosis in CRC cells.
Our study demonstrated that combining IDO1 inhibition with ferroptosis inducers synergistically enhances antitumor effects on CRC and offers a promising strategy to overcome resistance to monotherapies. This approach can be particularly valuable for patients with IDO1-overexpressing tumors, and it potentially improves outcomes in clinical settings where current immunotherapies show limited efficacy. However, this study encountered some limitations. In subsequent experiments, we will validate our findings using a CRC mouse model and explore specific signaling pathways to reveal the coordinated role of ferroptosis with IDO1 inhibitors.
SUMMARY
We have demonstrated the regulatory relationship between ferroptosis and IDO1. The ferroptosis inducer Erastin/RSL3 increased IDO1 expression, and IDO1 knockdown promoted ferroptosis in CRC cells. Combined IDO1 knockdown and treatment with Erastin or RSL3 significantly suppressed CRC cell functions and promoted CRC cell ferroptosis. Combination therapy with IDO1 inhibitor and ferroptosis inducer may be an effective means to improve treatment efficacy in CRC.
AVAILABILITY OF DATA AND MATERIALS
The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.
ABBREVIATIONS
3-HAA: 3-hydroxyanthranilic acid
3-HK: 3-Hydroxy-kynurenine
ACSL4: Acyl-CoA synthetase long-chain family member 4
ANOVA: analysis of variance
CCK-8: Cell counting kit-8
COX-2: Cyclooxygenase-2
CRC: Colorectal cancer
CTLs: Cytotoxic T-lymphocytes
DMEM: Dulbecco’s Modified Eagle Medium
ELISA: Enzyme-linked immunosorbent assay
FBS: Fetal bovine serum
FTH1: Ferritin heavy polypeptide 1
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
GPX4: Glutathione peroxidase 4
GSH: Glutathione
HRP: Horse radish peroxidase
ICIs: Immune checkpoint inhibitors
IDO1: Indoleamine 2,3-dioxygenase 1
IFN-γ: Interferon-gamma
IL-4I1: Interleukin-4-induced protein 1
KP: Kynurenine pathway
Kyn: Kynurenine
MDA: Malondialdehyde
NADPH: Nicotinamide adenine dinucleotide phosphate
NOX1: Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 1
NRF2: Nuclear factor E2-related factor 2
ns: No significance
PBS: Phosphate-buffered saline
ROS: Reactive oxygen species
RT: Room temperature
RT-qPCR: Reverse transcription quantitative polymerase chain reaction
SAS: Sulfasalazine
SLC7A11: Solute carrier family 7 member 11
TBST: Tris-buffered saline with Tween 20
TDO: Tryptophan-2,3-dioxygenase
Tregs: Regulatory T cells
AUTHOR CONTRIBUTIONS
FL and SMS: Conceived and designed the current study; TXX, YPL, JJX, and XWZ: Performed the experiments and analyzed the data; FL, TXX, YPL, JJX, and XWZ: Wrote the manuscript; and SMS: Revised the manuscript critically for important intellectual content. All authors aptitude to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All authors have read and approved the final manuscript. All authors are meet for ICMJE authorship.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
Ethical approval and consent to participate is not required as this study only conducted experimental verification on in vitro cell lines.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Not applicable.
References
- Metabolic reprogramming and cancer progression. Science. 2020;368:eaaw5473.
- [CrossRef] [PubMed] [Google Scholar]
- Metabolic alterations in the tumor microenvironment and their role in oncogenesis. Cancer Lett. 2020;484:65-71.
- [CrossRef] [PubMed] [Google Scholar]
- Mapping the metabolic networks of tumor cells and cancer-associated fibroblasts. Cells. 2021;10:304.
- [CrossRef] [PubMed] [Google Scholar]
- Tryptophan metabolism in health and disease. Cell Metab. 2023;35:1304-26.
- [CrossRef] [PubMed] [Google Scholar]
- Tryptophan metabolites modulate inflammatory bowel disease and colorectal cancer by affecting immune system. Int Rev Immunol. 2022;41:326-45.
- [CrossRef] [PubMed] [Google Scholar]
- Tryptophan metabolism and disposition in cancer biology and immunotherapy. Biosci Rep. 2022;42:BSR20221682.
- [CrossRef] [PubMed] [Google Scholar]
- IDO1 in cancer: A Gemini of immune checkpoints. Cell Mol Immunol. 2018;15:447-57.
- [CrossRef] [PubMed] [Google Scholar]
- IDO1: An important immunotherapy target in cancer treatment. Int Immunopharmacol. 2017;47:70-7.
- [CrossRef] [PubMed] [Google Scholar]
- Therapeutic targeting of inflammation and tryptophan metabolism in colon and gastrointestinal cancer. Transl Res. 2016;167:67-79.
- [CrossRef] [PubMed] [Google Scholar]
- Tryptophan and indole metabolism in immune regulation. Curr Opin Immunol. 2021;70:7-14.
- [CrossRef] [PubMed] [Google Scholar]
- Clinicopathological significance of indoleamine 2,3-dioxygenase 1 expression in colorectal cancer. Br J Cancer. 2012;106:141-7.
- [CrossRef] [PubMed] [Google Scholar]
- Indoleamine-2,3-dioxygenase 1/cyclooxygenase 2 expression prediction for adverse prognosis in colorectal cancer. World J Gastroenterol. 2018;24:2181-90.
- [CrossRef] [PubMed] [Google Scholar]
- Effect of taxane chemotherapy with or without indoximod in metastatic breast cancer: A randomized clinical trial. JAMA Oncol. 2021;7:61-9.
- [CrossRef] [PubMed] [Google Scholar]
- Population pharmacokinetic and pharmacodynamic modeling of epacadostat in patients with advanced solid malignancies. J Clin Pharmacol. 2017;57:720-9.
- [CrossRef] [PubMed] [Google Scholar]
- Phase ia study of the indoleamine 2,3-dioxygenase 1 (IDO1) inhibitor navoximod (GDC-0919) in patients with recurrent advanced solid tumors. J Immunother Cancer. 2018;6:61.
- [CrossRef] [PubMed] [Google Scholar]
- Ferroptosis: Past, present and future. Cell Death Dis. 2020;11:88.
- [CrossRef] [PubMed] [Google Scholar]
- Ferroptosis in cancer therapy: A novel approach to reversing drug resistance. Mol Cancer. 2022;21:47.
- [CrossRef] [PubMed] [Google Scholar]
- Ferroptosis in cancer and cancer immunotherapy. Cancer Commun (Lond). 2022;42:88-116.
- [CrossRef] [PubMed] [Google Scholar]
- The critical role and molecular mechanisms of ferroptosis in antioxidant systems: A narrative review. Ann Transl Med. 2022;10:368.
- [CrossRef] [PubMed] [Google Scholar]
- The role of erastin in ferroptosis and its prospects in cancer therapy. Onco Targets Ther. 2020;13:5429-41.
- [CrossRef] [PubMed] [Google Scholar]
- PR/SET domain 1 targeting glutathione peroxidase 4 regulates chronic hepatitis B liver fibrosis through ferroptosis. Cytojournal. 2024;21:78.
- [CrossRef] [PubMed] [Google Scholar]
- The gut microbiota metabolite capsiate promotes Gpx4 expression by activating TRPV1 to inhibit intestinal ischemia reperfusion-induced ferroptosis. Gut Microbes. 2021;13:1-21.
- [CrossRef] [Google Scholar]
- Kynurenine importation by SLC7A11 propagates anti-ferroptotic signaling. Mol Cell. 2022;82:920-932.e7.
- [CrossRef] [PubMed] [Google Scholar]
- Anti-ferroptotic mechanism of IL4i1-mediated amino acid metabolism. Elife. 2021;10:e64806.
- [CrossRef] [PubMed] [Google Scholar]
- Inhibition of GCN2 sensitizes ASNS-low cancer cells to asparaginase by disrupting the amino acid response. Proc Natl Acad Sci U S A. 2018;115:E7776-85.
- [CrossRef] [PubMed] [Google Scholar]
- The emerging roles of IDO2 in cancer and its potential as a therapeutic target. Biomed Pharmacother. 2021;137:111295.
- [CrossRef] [PubMed] [Google Scholar]
- IL4I1 is a metabolic immune checkpoint that activates the ahr and promotes tumor progression. Cell. 2020;182:1252-70.e34.
- [CrossRef] [PubMed] [Google Scholar]
- CD8+ T cells regulate tumour ferroptosis during cancer immunotherapy. Nature. 2019;569:270-4.
- [CrossRef] [PubMed] [Google Scholar]
- Anti-PD-L1 dnazyme loaded photothermal MN2+/Fe3+ hybrid metal-phenolic networks for cyclically amplified tumor ferroptosisimmunotherapy. Adv Healthc Mater. 2022;11:e2102315.
- [CrossRef] [PubMed] [Google Scholar]
- Inhibition of ALG3 stimulates cancer cell immunogenic ferroptosis to potentiate immunotherapy. Cell Mol Life Sci. 2022;79:352.
- [CrossRef] [PubMed] [Google Scholar]
- A dual PI3K/HDAC inhibitor induces immunogenic ferroptosis to potentiate cancer immune checkpoint therapy. Cancer Res. 2021;81:6233-45.
- [CrossRef] [PubMed] [Google Scholar]
- USP14 promotes tryptophan metabolism and immune suppression by stabilizing IDO1 in colorectal cancer. Nat Commun. 2022;13:5644.
- [CrossRef] [PubMed] [Google Scholar]
- IDO1 expression is associated with immune tolerance and poor prognosis in patients with surgically resected esophageal cancer. Ann Surg. 2019;269:1101-8.
- [CrossRef] [PubMed] [Google Scholar]
- PDPN positive CAFs contribute to HER2 positive breast cancer resistance to trastuzumab by inhibiting antibody-dependent NK cell-mediated cytotoxicity. Drug Resist Updat. 2023;68:100947.
- [CrossRef] [PubMed] [Google Scholar]
- Expression of indoleamine 2, 3-dioxygenase 1 (IDO1) and tryptophanyl-tRNA synthetase (WARS) in gastric cancer molecular subtypes. Appl Immunohistochem Mol Morphol. 2020;28:360-8.
- [CrossRef] [PubMed] [Google Scholar]
- Dual nicotinamide phosphoribosyltransferase (NAMPT) and indoleamine 2,3-dioxygenase 1 (IDO1) inhibitors for the treatment of drug-resistant nonsmall-cell lung cancer. J Med Chem. 2023;66:1027-47.
- [CrossRef] [PubMed] [Google Scholar]
- What is the prospect of indoleamine 2,3-dioxygenase 1 inhibition in cancer? Extrapolation from the past. J Exp Clin Cancer Res. 2021;40:60.
- [CrossRef] [PubMed] [Google Scholar]
- Epacadostat plus pembrolizumab versus placebo plus pembrolizumab in patients with unresectable or metastatic melanoma (ECHO-301/KEYNOTE-252): A phase 3, randomised, double-blind study. Lancet Oncol. 2019;20:1083-97.
- [CrossRef] [PubMed] [Google Scholar]
- Phase I study of the indoleamine 2,3-dioxygenase 1 (IDO1) inhibitor navoximod (GDC-0919) administered with PD-L1 inhibitor (Atezolizumab) in advanced solid tumors. Clin Cancer Res. 2019;25:3220-8.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular mechanisms of ferroptosis and its role in cancer therapy. J Cell Mol Med. 2019;23:4900-12.
- [CrossRef] [PubMed] [Google Scholar]
- Converting cold into hot tumors by combining immunotherapies. Cell. 2017;170:1055-6.
- [CrossRef] [PubMed] [Google Scholar]
- Ferroptosis: Molecular mechanisms and health implications. Cell Res. 2021;31:107-25.
- [CrossRef] [PubMed] [Google Scholar]
- Synthetic lethal screening identifies compounds activating iron-dependent, nonapoptotic cell death in oncogenic-RAS-harboring cancer cells. Chem Biol. 2008;15:234-45.
- [CrossRef] [PubMed] [Google Scholar]
- Ferroptosis, a novel pharmacological mechanism of anti-cancer drugs. Cancer Lett. 2020;483:127-36.
- [CrossRef] [PubMed] [Google Scholar]
- A systematic review of the efficacy and safety experience reported for sorafenib in advanced renal cell carcinoma (RCC) in the post-approval setting. PLoS One. 2015;10:e0120877.
- [CrossRef] [PubMed] [Google Scholar]
- Ferroptosis: A novel anti-tumor action for cisplatin. Cancer Res Treat. 2018;50:445-60.
- [CrossRef] [PubMed] [Google Scholar]

