Ginsenoside Rb1 attenuates erythropoietin-exacerbated vascular calcification in chronic kidney disease through BMP2-dependent Smad1/5/9 inhibition

Rat calcification model establishment

Eight-week-old male Sprague-Dawley (SD) rats, weighing between 180 g and 220 g, were obtained from Ensiweier Biotechnology Co., Ltd. (Chongqing, China). All rats were confined under standardized conditions, with unrestricted access to food and water, and maintained on a 12 h light/dark cycle. The environmental conditions were regulated to a temperature of 23 ± 2°C and a humidity of 35–60%, with adaptive feeding for 7 days. Given that an adenine-induced diet can cause renal failure in rats, which is similar to the pathological process in humans, and the process is simple with reduced stress response in rats, an adenine diet was chosen to establish a rat model of CKD.^[25] The control group was fed a standard diet, whereas the CKD group was fed a diet containing 0.75% adenine (Merck, A9126-25G, Shanghai, China) for 8 weeks to establish a model of calcification in CKD rats.^[26]

Construction and packaging of adeno-associated virus (AAV)-GATA6 shRNA AAV vector

pAAV-EnCMV-MCS-U6-shRNA was used as the GATA6 knockdown vector. Two sequences (GATA6-F: 5' GATCCGTAGCGTGAGTGGCGGTGGCGGCTCGAG CCGCCACCGCCACTCACGCTATTTTTTG 3' ; GATA 6-R: 5' AATTCAAAAAATAGCGTGAGTGGCGGTGGCGGC TCGAGCCGCCACCGCCACTCACGCTACG 3') were inserted into the BamHI-HindIII restriction sites of the pAAV-EnCMV-MCS-U6-shRNA plasmid, generating AAVGATA6 shRNA. AAV-vector was used as a control. A three-plasmid AAV system was employed for viral packaging. 293T cells (CVCL_1926, CRL-11268, ATCC, Manassas, VA, USA) were cultured to 80–90% confluency before transfection. AAV-GATA6 shRNA and AAV-vector were transfected into 293T cells using a Max Transfection Reagent (24765-1, BioMedicine, Chongqing, China). After 72 h, cell pellets were collected and subjected to three freeze-thaw cycles (−80°C/37°C water bath) to release AAV particles (the serotype of AAV was AAV9).

Animal grouping and treatment

Sixty SD rats were randomly assigned to five groups (n = 12 each) after successful establishment of the CKD model: Control group, CKD group, and CKD + EPO groups (1000, 1500, and 2000 U/kg/W). The EPO groups received intraperitoneal injections of EPO (592302, bioleg, San Diego, CA, USA) 3 times/week in accordance with their respective dosages. EPO treatments were administered at the same time as adenine. The control and CKD groups were given an equivalent volume of saline (S790534-500 mL, Macklin, Shanghai, China). Eight weeks later, the rats were anesthetized with 50 mg/kg of pentobarbital sodium (P3761, BSZH Scientific Inc., Beijing, China) through intraperitoneal injection and euthanized by cervical dislocation. Blood and abdominal aortic samples were harvested for analysis.

For the AAV-GATA6 shRNA-interfered CKD model, 48 SD rats were divided into four groups (n = 12 each): control group, CKD + EPO high-dose group (2000 U/kg/W), CKD + EPO + AAV-vector (AAV-vector) group, and CKD + EPO + AAVGATA6 shRNA (AAV-GATA6 shRNA) group. The rats were injected with the corresponding AAV through the tail vein (100 μL/rat; the serotype was AAV9, and the virus titer was 5.0 × 10¹¹ μg/mL^[27]) in accordance with their group assignment. The remaining two groups received an equivalent volume of saline. After 4 weeks, the rats were treated simultaneously with 0.75% adenine and EPO at high doses (2000 U/kg/W, 3 times/week). The control group was injected with an equal amount of saline daily. After 8 weeks, all rats were anesthetized to collect blood, 1 mL of phenobarbital sodium (≥150 mg/kg) was injected intravenously into rats for euthanasia. The signs of respiratory cessation, disappearance of heartbeat, and loss of corneal reflex were observed to confirm their death. Finally, the rats were dissected and the abdominal aortic tissues were collected for subsequent research.

For the Rb1-treated CKD model, 60 SD rats were divided into five groups (12 rats per group): control group, CKD + EPO high-dose group (2000 U/kg/W), and CKD + EPO + Rb1 groups (Rb1: 20, 40, and 60 mg/kg/day). The dosage of Rb1 was determined by referring to the existing research results.^[28-30] In accordance with the grouping, the rats were treated simultaneously with 0.75% adenine and high-dose EPO (2000 U/kg/W, 3 times/week). After 8 weeks, the Rb1 group was injected intraperitoneally with Rb1 (BP4107, G-CLONE, Beijing, China) daily at the indicated doses. The control and CKD groups were injected with an equal amount of saline daily. After 8 weeks, all rats were anesthetized for blood collection and then 1 mL of phenobarbital sodium (≥ 150 mg/kg) was injected intravenously into rats for euthanasia. Finally, abdominal aortic tissue samples were collected for subsequent analysis.

The animal study was conducted following the ARRIVE guidelines. All animal experimental procedures complied with the ethical standards of and approved by the Ethical Committee on Welfare of Laboratory Animals, Chongqing Traditional Chinese Medicine Hospital (2024-DWSY-LXJ, ethical approval date: August 15, 2024).

Enzyme-linked immunosorbent assay

Whole blood samples were stored at 4°C overnight and then centrifuged at 2–8°C for 15 min at 3000 rpm (SLX-1024F, Servicebio, Beijing, China). Blood was then collected, and plasma concentrations of hemoglobin, creatinine, ALP, phosphorus, and calcium were quantified using an automated biochemical analyzer (Chemray 240, Rayto, Shenzhen, China) and corresponding kits (Nanjing Jianjian Bioengineering Institute, Nanjing, China).

Von Kossa staining

Abdominal aortic tissue sections were fixed with 4% paraformaldehyde (C104190-500 g, Aladdin, Shanghai, China), embedded with paraffin, dewaxed, and rehydrated. Then, von Kossa stain (G1043, Servicebio, Beijing, China) was applied to the sections, followed by UV irradiation for 1 h until color development was complete. Hematoxylin staining was performed for 3–5 min, and the sections were rinsed with distilled water and blued with a bluing reagent. The sections were dehydrated with different concentrations of ethanol, stained with eosin (Servicebio, G1043-3, Wuhan, China) for 5 min, dehydrated again, washed with xylene, mounted with resin (10004160, Sinopharm, Beijing, China), and viewed under a microscope (Nikon Eclipse E100, Nikon, Japan) to capture images. Von Kossa staining was evaluated on the basis of the average optical density of positive reactions using Image-Pro Plus (version 6.0) software (Media Cybernetics, Inc., Rockville, MD, USA).

Alizarin red staining

The calcium deposits in the aortic tissue and VSMCs were stained using Alizarin Red S solution (G1038, Servicebio, Beijing, China). The 4% paraformaldehyde-fixed aortic tissues and VSMCs were exposed to Alizarin Red S solution for 5–10 min, adjusting the staining time in accordance with the calcium content, and then washed again with distilled water. Calcium deposits were observed and imaged under a microscope (Nikon Eclipse E100, Nikon, Japan). They are shown as red areas.

Immunofluorescence

Abdominal aortic tissues were fixed in paraformaldehyde, followed by standard paraffin embedding and deparaffinization/rehydration as described for von Kossa staining. Antigen repair was performed by microwave irradiation in ethylenediaminetetraacetic acid. The tissue sections were then incubated with 5% normal goat serum (C0265, Beyotime, Shanghai, China) in PBS/0.1% Triton X-100 solution for 1 h at room temperature. They were incubated overnight at 4°C with SM22a rabbit mAb (1:200, A21209, ABclonal, Wuhan, China) or a-SMA rabbit mAb (1:200, A2235, RRID: AB_2862980, ABclonal, Wuhan, China). Afterward, the slices were incubated for 1.5 h with fluorescein (FITC)-labeled goat anti-rabbit immunoglobulin G (IgG, 1:200, GB22303, RRID: AB_2904189, Servicebio, Wuhan, China). After the sections were thoroughly washed with PBS, the nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (C1005, Beyotime, Shanghai, China) and visualized under a fluorescence microscope (MF53, Mshot, Guangzhou, China). Then, the images were imported into Image-Pro Plus (version 6.0) software (Media Cybernetics, Inc., Rockville, MD, USA). The threshold was adjusted, and appropriate regions of interest (ROIs) and thresholding algorithms were selected. Within the designated ROI, the “Measure” function was utilized to quantify the fluorescence signal intensity, and the “Mean gray value” was chosen as the quantitative indicator for the average fluorescence intensity.

Real-time quantitative polymerase chain reaction (RT-qPCR)

TRIzol reagent (CW0580S, ComWin, Beijing, China) was utilized for total RNA extraction of aortic tissues. RNA was reverse transcribed into cDNA using a Goldenstar RT6 cDNA Synthesis Kit (version 2, TSK302M, Tsingke, Beijing, China). Quantitative PCR was conducted using a real-time PCR system (IQ5, Bio-Rad, USA) with 2 × T5 Fast qPCR Mix (SYBR Green I, TSE202, Tsingke, Beijing, China) following the manufacturer’s instructions. GAPDH was used as an internal control. The relative mRNA expression was calculated by 2^–ΔΔCt method. The detailed gene primer sequence information is displayed in Table 1.

Co-immunoprecipitation (Co-IP) and Western blot (WB) analysis

RIPA lysis solution (P0013B, Beyotime, Shanghai, China) and protease and phosphatase inhibitors were used to lyse the harvested VSMCs for 15 min on ice. Afterward, the lysate was sonicated for 2 min at 10% power on ice. The supernatant was precleared by incubating it with protein A + G magnetic beads (Millipore) and IgG (CST) for 1 h at 4°C following centrifugation at 12,000 g for 20 min at 4°C. Next, the samples spent 1 min in a magnetic separator. On a rotating platform, the supernatant was incubated with the specified antibody for the entire night at 4°C. After protein A + G magnetic beads were added to the supernatants, they were allowed to sit at room temperature for 2 h. The immunocomplexes were washed 3 times with lysis buffer, boiled at 95°C for 10 min with 2× sodium dodecyl sulfate (SDS) sample buffer, and analyzed by WB.

For WB analysis, a small amount of aortic tissue was homogenized in RIPA lysis buffer (P0013B, Beyotime, Shanghai, China). Total protein was quantified by BCA method (Pierce, #23225). Equal amounts of proteins in each sample were separated by 12% SDS-polyacrylamide gel electrophoresis (G2083, Servicebio, Beijing, China), and then, the separated proteins were transferred onto the polyvinylidene difluoride (PVDF, 10600023, Cytiva, Shanghai, China) membrane. The membranes were incubated with GATA6 (rabbit monoclonal antibody, 1:1000, ab317012, Abcam, Shanghai, China), BMP2 (RRID: AB_2757044, rabbit polyclonal antibody, A0231, ABclonal, Wuhan, China; used for Co-IP: rabbit monoclonal antibody, 1:1000, ab284387, Abcam, Shanghai, China), BMPR (RRID: AB_10856745, rabbit polyclonal antibody, 1:1000, bs-1509R, Bioss, Beijing, China), Smad1/5/9 (RRID: AB_2834266, rabbit polyclonal antibody, 1:1000, AF0614, Affinity, Liyang, China), p-Smad1/5/9 (RRID: AB_2840375, rabbit polyclonal antibody, 1:1000, AF8313, Affinity, Liyang, China), and the endogenous reference GAPDH (RRID: AB_ 2862549, rabbit monoclonal antibody, A19056, ABclonal, Wuhan, China). The primary antibodies were incubated at 4°C overnight. After being washed, the PVDF film was incubated with goat anti-rabbit IgG horseradish peroxidase-coupled secondary antibody (RRID: AB_2769854, 1:2000, AS014, Abclonal, Wuhan, China) for 1 h at room temperature. An ECL kit (34580, Thermo, MA, USA) was used for detection, and the ECL exposure solution evenly covered the whole film. The reaction was placed into a gel imager (Universal Hood II, Bio-Rad, USA) after 1 min. Densitometric analysis was performed using ImageJ software to determine the relative protein expression, and the ratio of the gray value of the target band to the gray value of the internal reference (GAPDH) band was used as the relative expression of the target protein.

VSMC culture and treatment

The correct rat VSMC cell line (MZ-336123, MINGZHOUBIO, Ningbo, China), which has been authenticated by the manufacturer through STR profiling, was cultured in DMEM (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (AC03L055, Life iLab, Shanghai, China) and 1% penicillin/streptomycin (C0222, Beyotime, Shanghai, China), with medium changes every 2 days. Logarithmically grown cells were divided into five groups [(control group, EPO group, and EPO + Rb1 groups (20, 40, and 80 μM] for culture. In all groups except the control group, 250 U/mL of EPO (HY-P73040, MCE, USA) and 10 mmol/L of b-glycerophosphate (MB3195-1, MeilunBio, Dalian, China) were added to induce VSMC calcification. The Rb1 groups received 20, 40, and 80 μM of Rb1 (MB6856-1, MeilunBio, Dalian, China) accordingly. The dosage of Rb1 used for cell treatment was determined on the basis of the findings of previous studies and those of our own preliminary experiments.^[29] The cells were incubated for 14 days at 37°C in a 5% CO₂ incubator (BPH-9042, Yiheng, Shanghai, China) before collection. VSMCs were tested quarterly for mycoplasma contamination using PCR-based methods, and the results were negative.

Molecular docking

Molecular docking of Rb1 and BMP2 mimicry was performed on the basis of literature and previous studies.^[31] Docking was performed using standard protocols. The crystal structure of the BMP2 protein was downloaded from the PDB database (protein number: 6OMN), and then, molecular docking of human BMP2 and Rb1 monomers was performed using Autodock4.2 (Scripps Research, La Jolla, California, USA) software and visualized by Discovery Studio 2021 Client software.

Biotin pulldown assay

Biotinylated Rb1 was mixed thoroughly with extracted total protein. This mixture was incubated with streptavidin-coated magnetic beads (HY-K0208, MCE, USA) to pull down the biotin-captured protein complexes, which were then analyzed by WB to identify Rb1-binding proteins.

Microscale thermophoresis (MST)

BMP2 was labeled using the RED-NHS Protein Labeling Kit (MO-L011, Monolith, Germany), following the protocol provided by the manufacturer and using the buffer provided to label the BMP2 protein with a molar ratio of dye to protein of 2–3:1. The mixtures were incubated in the dark at room temperature for 30 min to remove any unbound dye. Absorbance was measured at 280 and 650 nm using a nanophotometer (NanoDrop One/One C, Thermo, USA) to determine labeling efficiency (F/P). Rb1 was then mixed with labeled BMP2, and the mixture was analyzed using a Monolith NT.115 MST instrument (NanoTemper, Germany) to determine the thermophoretic coefficients at different drug concentrations. Data were fitted and dissociation constants (Kd) were determined using MO.affinity Analysis (version 2.3) software (NanoTemper Technologies, Germany).

Statistical analysis

Data were analyzed using GraphPad Prism (version 10.0). The results are expressed as mean ± standard deviation. One-way analysis of variance was employed, supplemented by Tukey’s multiple comparison post hoc analysis, to assess differences across various groups. Statistical significance was determined with P-value threshold of <0.05.

EPO-induced exacerbation of VC in CKD rats

In this study, whether EPO treatment aggravated VC in CKD rats was determined. A CKD model was established by feeding rats with food containing 0.75% adenine for 8 weeks, and the hemoglobin, serum creatinine, ALP, phosphorus, and calcium levels in the CKD rats after treatment with different doses of EPO were evaluated. The results showed that the plasma levels of serum creatinine, ALP, phosphorus, and calcium were significantly higher in the CKD rats than in the control group (P < 0.01), whereas the hemoglobin concentration was significantly lower (P < 0.01). The hemoglobin, serum creatinine, ALP, phosphorus, and calcium levels in the plasma of EPO-treated rats were significantly upregulated compared with those in the CKD group (P < 0.01) in a dose-dependent manner [Figure 1a-e]. Von Kossa staining and Alizarin Red staining were performed to further characterize the effect of EPO on VC in CKD rats and determine the calcium deposition in the abdominal aorta. As shown in Figure 1f-h, calcium deposition was observed in the abdominal aorta of CKD rats, and it significantly increased when treated with a high dose of EPO (2000 U/kg/W, P < 0.01). These results suggest that EPO induces VC in a dose-dependent manner in CKD rats.

Close

Figure 1:

Effects of different doses of EPO on aortic calcification in CKD rats. (a) Level of hemoglobin in the serum of rats in the control, CKD, and CKD + EPO (1000, 1500, and 2000 U/kg/W) groups (n = 6). (b) Level of creatinine in the serum of rats in each group (n = 6). (c) Level of ALP in the serum of rats. (d) Phosphorus levels in the serum of rats in each group (n = 6). (e) Calcium levels in the serum of rats in each group (n = 6). (f) Von Kossa and Alizarin Red staining in aortic tissues (scale = 50 μm, n = 3). (g and h) Statistical analysis of the average positive area of von Kossa staining and Alizarin Red staining. Data are expressed as mean ± standard deviation. ^✶P < 0.05, ^✶✶P < 0.01, and ns indicates no statistical significance. EPO: Erythropoietin, CKD: Chronic kidney disease, ALP: Alkaline phosphatase.

Export to PPT

EPO-induced changes in abdominal aortic membrane properties in CKD model rats

The expression levels of contractile markers of VSMC, such as smooth muscle protein 22-a (SM22a) and a-Smooth muscle actin (a-SMA), were assessed to examine the effect of EPO on the phenotypic transformation of VSMC in the abdominal aortic membrane of CKD model rats. As shown in Figure 2a-d, the levels of SM22a and a-SMA were significantly lower in the CKD group than in the control group (P < 0.01). EPO downregulated the expression levels of SM22a and a-SMA in the abdominal aortic membrane of CKD rats in a dose-dependent manner. RT-qPCR analysis showed that the mRNA levels of SM22a (P < 0.05) and a-SMA (P < 0.01) in the CKD group were significantly reduced compared with those in the control group [Figure 2e and f]. Meanwhile, the mRNA levels of BMP2 significantly increased (P < 0.05), and this trend was further amplified after EPO intervention [Figure 2g]. These data suggest that EPO exacerbated calcification in the abdominal aorta of CKD model rats by further upregulating BMP2 and downregulating SM22a and a-SMA. A previous study showed that increased GATA6 expression in EPO-treated VMSC bound to BMP2 and enhanced its transcription, leading to the calcification of VMSC.^[32] Therefore, the possible molecular mechanisms of EPO-induced calcification were explored. WB analysis revealed that the levels of BMP2 (P < 0.01), GATA6 (P < 0.01), and BMP2 downstream signaling proteins p-Smad1/5/9 (P < 0.01) in the abdominal aortic membranes of the CKD rats significantly increased compared with those of the control group. EPO treatment further increased the expression levels of GATA6, BMP2, and p-Smad1/5/9 in a dose-dependent manner [Figure 2h-k]. These findings suggest that EPO may exacerbate calcification in CKD through the GATA6/BMP2/Smad1/5/9 pathway.

Close

Figure 2:

Dose-dependent response of aortic calcification to EPO in CKD rats. (a and b) Immunofluorescence detection of the effect of EPO on the expression levels of SM22a and a-SMA in the abdominal aortic membrane tissue of CKD rats. (c and d) Statistical analysis of the average fluorescence intensity of SM22a and a-SMA. (e-g) RT-qPCR characterization of the effect of EPO on the mRNA levels of SM22a, a-SMA, and BMP2 in the abdominal aortic membrane tissues of CKD rats. (h) WB detection of the effect of EPO on the protein expression levels of GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9 in the abdominal aortic tunica media tissue of CKD rats. (i-k) Gray value statistics for GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9. Scale bar = 50 μm, n = 3. Data are shown as mean ± standard deviation. ^✶P < 0.05 and ^✶✶P < 0.01. EPO: Erythropoietin, CKD: Chronic kidney disease, a-SMA: a-Smooth muscle actin, SM22a: Smooth muscle protein 22-a, DAPI: 4’,6-Diamidino-2-phenylindole, RT-qPCR: Real-time quantitative PCR, BMP2: Bone morphogenetic protein 2, GATA6: GATA-binding protein 6, WB: Western blot, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Export to PPT

EPO exacerbation of VC disease in CKD rats by promoting GATA6 expression

An AAV-GATA6 shRNA-interfered CKD model was constructed for determining the effects of GATA6 in EPO-mediated VC in CKD rats to further determine the role of the GATA6/BMP2/Smad1/5/9 signaling pathway in EPO-promoted VC calcification. Quantitative WB assay revealed that compared with the AAV-vector group, the AAV-GATA6 shRNA group showed a significant reduction in GATA6 protein expression in the aortic tissues of EPO-treated CKD rats (P < 0.01), indicating successful AAV-GATA6 shRNA AAV transduction [Figure 3a and b]. Notably, the BMP2, p-Smad1/5/9, and Smad1/5/9 protein levels in the AAV-GATA6 shRNA group were significantly downregulated compared with those in the AAV-vector group (P < 0.01, [Figure 3c and d]). RT-qPCR analysis revealed that the trend of BMP2 mRNA expression was consistent with that of the protein levels (P < 0.01, [Figure 3e]). Von Kossa staining (P < 0.05) and Alizarin Red staining (P < 0.01, [Figure 3f-i]) showed that the deletion of GATA6 significantly blocked the pro-calcification effect of EPO. Meanwhile, immunofluorescence detection and RT-qPCR analysis revealed that SM22a and a-SMA, which were affected by GATA6 deficiency, increased in the abdominal aortic tissues of CKD rats (P < 0.01, [Figure 3j-o]). This finding indicated that EPO can aggravate VC in CKD rats by activating the GATA6/BMP2/Smad1/5/9 signaling pathway.

Close

Figure 3:

GATA6 deficiency impeding EPO-mediated deterioration of VC in CKD rats. (a) WB detection of the protein expression levels of GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9 in the control, CKD + EPO, AAV-vector, and AAV-GATA6 shRNA groups. (b-d) Gray value statistics for GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9. (e) RT-qPCR analysis of the expression of BMP2 mRNA in the abdominal aortic tissues of CKD rats with EPO-mediated intervention by AAV-GATA6 shRNA. (f and g) Von Kossa and Alizarin Red staining of the abdominal aorta in the control, CKD + EPO, AAV-vector, and AAV-GATA6 shRNA groups. (h and i) Statistical analysis of the average positive area of von Kossa staining and Alizarin Red staining. (j) Immunofluorescence staining of SM22a. (k) Statistical analysis of the average fluorescence intensity of SM22a. (l) RT-qPCR measurements of SM22a mRNA in rat aortic tissues. (m) Immunofluorescence staining of a-SMA. (n) Statistical analysis of the average fluorescence intensity of a-SMA. (o) RT-qPCR measurements of a-SMA mRNA in rat aortic tissues. Scale = 50 μm, n = 3. Data are expressed as mean ± standard deviation. ^✶P < 0.05, ^✶✶P < 0.01, and ns indicates no statistical significance. GATA6: GATA-binding protein 6, EPO: Erythropoietin, VC: Vascular calcification, CKD: Chronic kidney disease, WB: Western blot, AAV: Adeno-associated virus, BMP2: Bone morphogenetic protein 2, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, RT-qPCR: Real-time quantitative polymerase chain reaction, a-SMA: a-Smooth muscle actin, SM22a: Smooth muscle protein 22-a, DAPI: 4’,6-Diamidino-2-phenylindole.

Export to PPT

Rb1 amelioration of EPO-exacerbated VC deterioration in a dose-dependent manner

The levels of hemoglobin, serum creatinine, ALP, phosphorus, and calcium after Rb1 treatment were examined to assess the effect of Rb1 on calcification in EPO + CKD rats. The results showed that Rb1 had no significant effect on the hemoglobin level of EPO + CKD rats (P > 0.05). Meanwhile, Rb1 significantly reduced the serum creatinine, ALP, phosphorus, and calcium levels compared with CKD + EPO (P < 0.01), and the reduction effect was enhanced with the increase in dosage [Figure 4a-e]. Von Kossa staining and Alizarin Red staining showed that Rb1 attenuated the calcification of abdominal aortic tissues in a dose-dependent manner in CKD + EPO rats (P < 0.01, [Figure 4f-i]. These data suggest that Rb1 ameliorated VC in the abdominal aortic tissues of CKD + EPO rats.

Close

Figure 4:

Rb1 attenuation of EPO-induced VC in CKD rats. (a) Level of hemoglobin in the serum of control, CKD + EPO, and CKD + EPO + Rb1 (20, 40, and 60 mg/kg/d) groups (n = 6). (b) Level of creatinine in the serum of rats in each group (n = 6). (c) Level of ALP in the serum of rats in each group (n = 6). (d) Phosphorus levels in the serum of rats in each group (n = 6). (e) Calcium levels in the serum of rats in each group (n = 6). (f) Von Kossa staining in different experimental groups (scale = 50 μm, n = 3). (g) Statistical analysis of the average positive area of von Kossa staining. (h) Alizarin Red staining in different experimental groups (scale = 50 μm, n = 3). (i) Statistical analysis of the average positive area of Alizarin red staining. Data are expressed as mean ± standard deviation. ^✶P < 0.05, ^✶✶P < 0.01, and ns indicates no statistical significance. Rb1: Ginsenoside Rb1, VC: Vascular calcification, EPO: Erythropoietin, CKD: Chronic kidney disease, ALP: Alkaline phosphatase.

Export to PPT

Rb1 inhibition of EPO-mediated calcification and hindrance of Smad1/5/9 phosphorylation in the abdominal aorta of CKD rat model

Next, whether Rb1 could regulate that VSMC phenotypic transformation in vivo was determined. The immunization results showed that the levels of SM22a and a-SMA in the abdominal aortic tissues of the CKD + EPO + Rb1 group significantly increased compared with those of the CKD + EPO group (P < 0.01, [Figure 5a-d]). As shown in Figure 5e and f, Rb1 significantly upregulated the mRNA levels of SM22a and a-SMA in a dose-dependent manner (P < 0.01). However, Rb1 administration did not significantly affect the transcript levels of BMP2 in the abdominal aortic tissues of CKD + EPO rats (P > 0.05, [Figure 5g]). Notably, the expression levels of GATA6 and BMP2 proteins in the abdominal aortic tissues of the CKD + EPO rats were not affected by Rb1 (P > 0.05). However, Rb1 reduced the relative expression levels of p-Smad1/5/9 and Smad1/5/9 proteins in a dose-dependent manner (P < 0.01, [Figure 5h and i]). These results suggest that the inhibition of the Smad1/5/9 pathway by Rb1 may not act by blocking GATA6 and BMP2 expression.

Close

Figure 5:

Rb1 blockage of Smad1/5/9 pathway, leading to attenuation of EPO-induced calcification. (a) Immunofluorescence staining of SM22a. (b) Statistical analysis of the average fluorescence intensity of SM22a. (c) Immunofluorescence staining of a-SMA. (d) Statistical analysis of the average fluorescence intensity of a-SMA. (e-g) RT-qPCR detection of the mRNA levels of SM22a, a-SMA, and BMP2 in rat aortic tissues. (h) WB detection of the protein expression levels of GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9 in rat aortic tunica tissues. (i) Gray value statistics for GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9. Scale = 50 μm, n = 3. Data are expressed as mean ± standard deviation. ^✶P < 0.05, ^✶✶P < 0.01, and ns denotes no statistical significance. Rb1: Ginsenoside Rb1, EPO: Erythropoietin, CKD: Chronic kidney disease, a-SMA: a-Smooth muscle actin, SM22a: Smooth muscle protein 22-a, DAPI: 4’,6-Diamidino-2-phenylindole, BMP2: Bone morphogenetic protein 2, RTqPCR: Real-time quantitative polymerase chain reaction, WB: Western blot GATA6: GATA-binding protein 6, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Export to PPT

Rb1 inhibition of EPO-induced VSMC calcification in vitro

VSMCs were treated with 10 mM of b-glycerophosphate and 250 U/mL of EPO, followed by Rb1 (20, 40, or 80 μM), to assess whether Rb1 can mitigate the exacerbation of VC induced by EPO in vitro. As expected, the EPO-induced calcium deposition in VSMC in the Rb1-treated group was significantly attenuated compared with that in the EPO group (P < 0.01, [Figure 6a and b]) in an Rb1 dose-dependent manner. The results suggest that Rb1 alleviated VSMC calcification. Immunofluorescence labeling and RT-qPCR analysis showed that Rb1 significantly increased the expression levels of SM22a and a-SMA in VSMC in a dose-dependent manner, which is consistent with the results observed in vivo (P < 0.01, [Figure 6c-i]). The ALP activity of VSMC after Rb1 treatment was further examined. The ALP activity significantly decreased after Rb1 intervention (P < 0.01, [Figure 6j]). EPO treatment increased the expression levels of GATA6 and BMP2 in VSMC compared with control treatment (P < 0.01), but the inclusion of Rb1 did not significantly affect the expression levels of these proteins (P > 0.05, [Figure 6k-m]). However, the relative expression levels of p-Smad1/5/9 and Smad1/5/9 proteins significantly decreased with increasing Rb1 concentration compared with those in the EPO group (P < 0.01, [Figure 6n]). The results showed that Rb1 activated the Smad1/5/9 pathway and inhibited VSMC calcification.

Close

Figure 6:

Rb1 reduction in EPO-enhanced VSMC VC in vitro. (a) Alizarin Red staining of calcium deposits in VSMC (scale = 100 μm). (b) Statistical analysis of the average positive area of Alizarin Red staining. (c) Immunofluorescence staining of SM22a in VSMC (scale = 50 μm). d. Statistical analysis of the average fluorescence intensity of SM22a. (e) Immunofluorescence staining of a-SMA in VSMC (scale = 50 μm). (f) Statistical analysis of the average fluorescence intensity of a-SMA. (g-i) RT-qPCR detection of SM22a, a-SMA, and BMP2 mRNA expression levels in VSMC. (j) Detection of ALP activity in VSMC. (k) WB detection of the protein expression levels of GATA6, BMP2, Smad1/5/9 and p-Smad1/5/9 in VSMC. (l-n) Gray value statistics for GATA6, BMP2, Smad1/5/9, and p-Smad1/5/9. n = 3. Data are expressed as mean ± standard deviation. ^✶P < 0.05, ^✶✶P < 0.01, and ns denotes no statistical significance. Rb1: Ginsenoside Rb1, EPO: Erythropoietin, VC: Vascular calcification, VSMC: Vascular smooth muscle cell, a-SMA: a-Smooth muscle actin, SM22a: Smooth muscle protein 22-a, DAPI: 4’,6-Diamidino-2-phenylindole, BMP2: Bone morphogenetic protein 2, RT-qPCR: Real-time quantitative PCR, ALP: Alkaline phosphatase, WB: Western blot, GATA6: GATA-binding protein 6, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Export to PPT

Rb1 inhibition of Smad1/5/9 signaling axis through targeted binding to BMP2

A previous study reported that BMP2 can activate the Smad signaling pathway by binding to its serine kinase receptors (Bone morphogenetic protein receptor [BMPR]-IA, BMPR-IB, and BMPR-II), which induced osteogenic phenotypic shifts in VSMC and promoted calcification.^[33] Based on the above experimental results, Rb1 may affect the Smad pathway and VSMC calcification by regulating the binding of BMP2 and BMPR. The present study showed that Rb1 had robust hydrogen-bonding connections with BMP2 protein residues using network pharmacology and molecular docking techniques [Figure 7a]. Biotin traction assay showed that Rb1 could efficiently bind to BMP2 to form a stable protein complex [Figure 7b]. MST assay further confirmed the specific binding of Rb1 to BMP2. The results showed that Rb1 had a high binding affinity for BMP2 (Kd value = 413 μM, [Figure 7c]). Subsequently, the effect of Rb1 on the binding of BMP2 to BMPR in VSMC was investigated. Co-IP experiments showed that the binding of BMP2 to BMPR was significantly reduced in the Rb1-treated group [Figure 7d-f]. WB results showed that the expression levels of p-Smad1/5/9 and Smad1/5/9 in the EPO group significantly increased compared with those in the control group (P < 0.01). Rb1 treatment significantly reversed this result (P < 0.01, [Figure 7g and h]). These findings suggest that Rb1 may target binding to BMP2, preventing the binding of BMP2 to BMPR and thus hindering the activation of the downstream Smad signaling pathway.

Close

Figure 7:

Rb1 blockage of the binding of BMP2 to BMPR after targeting BMP2 for binding. (a) Molecular docking of Rb1 with BMP2 protein. (b) Biotin traction assay of the binding of Rb1 to BMP2. (c) MST assay of the binding of Rb1 to BMP2. (d) Co-IP quantification of BMP2 binding to BMPR in VSMC. (e and f) Gray value statistics of BMP2 and BMPR (IP/Input). (g) WB detection of the protein expression levels of Smad1/5/9 and p-Smad1/5/9 in VSMC. (h) Gray value statistics of Smad1/5/9 and p-Smad1/5/9. n = 3. Data are expressed as mean ± standard deviation. ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001, and ns denotes no statistical significance. Rb1: Ginsenoside Rb1, EPO: Erythropoietin, BMP2: Bone morphogenetic protein 2, MST: Microscale Thermophoresis, Co-IP: Co-immunoprecipitation, BMPR: Bone morphogenetic protein receptor, VSMC: Vascular smooth muscle cell, WB: Western blot, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Export to PPT