Translate this page into:
Jumonji domain-containing 6 promotes the expansion of neuroblastoma stem cells by activating the wingless/ integrated pathway
Juntao Xie
Zhe Xu
*Corresponding authors: Juntao Xie Department of Pediatric Surgery, First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China. xiejunt3@mail.sysu.edu.cn
Zhe Xu, Department of Pediatric Surgery, First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China. xzhe@mail.sysu.edu.cn
-
Received: ,
Accepted: ,
How to cite this article: Li Z, Gao W, Gao P, Fei Y, Chen H, Jiang H, et al. Jumonji domain-containing 6 promotes the expansion of neuroblastoma stem cells by activating the Wingless/Integrated pathway. CytoJournal. 2026;23:2. doi: 10.25259/Cytojournal_41_2025
Abstract
Objective:
Cancer stem cells are involved in chemotherapy resistance. Neuroblastoma (NB) is a common solid tumor in children, which is responsible for about 15% of pediatric cancer deaths. Jumonji domain-containing 6 (JMJD6), which is an arginine demethylase and lysine hydroxylase, regulates the progression of various tumors. However, the molecular mechanism underlying JMJD6’s activity in NB stem cells remains unclear. Thus, this study aims to explore the role of JMJD6 in NB stem cells.
Material and Methods:
Side population and sphere formation assays were used to investigate the role of JMJD6 in NB stem cell expansion. Immunohistochemistry was performed to determine the expression level of JMJD6 in NB tissues. Luciferase reporter assays were used to discover the effect of JMJD6 on the wingless/integrated (WNT) pathway.
Results:
JMJD6 was upregulated in NB tissues and cells (P < 0.05). NB patients with high JMJD6 levels had poor outcomes. JMJD6 could serve as an independent prognostic factor for NB. JMJD6 overexpression promoted NB stem cell expansion, whereas JMJD6 knockdown had the opposite effect, as determined by cell and animal models. Mechanism Roche studies showed that JMJD6 promoted NB stem cell expansion by activating the WNT pathway.
Conclusion:
JMJD6 promotes NB stem cell expansion by activating the WNT pathway, thereby providing a new target for NB therapy and a prognostic factor for patients with NB.
Keywords
Cancer stem cells
Jumonji domain-containing 6
Neuroblastoma
WNT pathway
INTRODUCTION
Neuroblastoma (NB) is a childhood cancer which develops in the sympathetic nervous system and stems from neural crest cells with aggressive growth and invasive properties.[1] It is the main cause of death from childhood cancer, causing approximately 15% of all pediatric cancer mortality.[2] In 1994, leukemic stem cells were isolated. Since then, cancer stem cells (CSCs) have been found in various other tumors.[3] CSCs are rare tumor cell subpopulations that are characterized by self-renew and differentiation. CSCs are frequently correlated with poor clinical outcomes.[4] NB shows high heterogeneity with three phenotypic variants: N type, S type, and I type. Tumors of the I type have the highest tumorigenic ability, and they are marked by Prominin 1 (also known as CD133) and KIT proto-oncogene receptor tyrosine kinase (C-Kit) expression. Thus, CD133 could be a marker for NB stem cells. CD133-positive NB stem cells are resistant to cisplatin, etoposide, doxorubicin, and paclitaxel treatments.[5,6] Some signaling pathways can drive NB stem cell expansion. Among them, the wingless/integrated (WNT) pathway plays a decisive role in NB cell lineages, and it is a key promoter for NB stem cell expansion.[7,8] Designing new therapies targeting NB stem cells might address drug resistance; therefore, studying the regulatory mechanism of NB stem cell formation is critical for NB.
Jumonji domain-containing 6 (JMJD6), which is a Fe (II) and 2-oxoglutarate-dependent dioxygenase, mediates lysylhydroxylation of U2AF65 (U2 small nuclear RNA auxiliary factor 2) to modulate RNA splicing activity.[9,10] The protein targets of JMJD6 act at multiple levels of messenger RNA (mRNA) processing, coordinating alternative splicing events governed by exons and the molecular delineation of exons.[11] Abnormal JMJD6 expression contributes to the progression of many types of tumors.[12] For example, JMJD6 promotes breast cancer proliferation, growth, and metastasis by suppressing the transforming growth factor-beta tumor-suppressor pathway.[13,14] Another study Liu et al. showed that JMJD6 acts as a tyrosine kinase to phosphorylate H2A.X variant histone at Y39, and the JMJD6-H2A.XY39ph axis promotes autophagy of triple-negative breast cancer by affecting autophagy-related gene expression, leading to tumor growth.[15] The JMJD6/ signal transducer and activator of transcription 3 (STAT3)/ interleukin (IL)-10 axis inhibits tumor-associated macrophage M2 polarization to suppress the efficacy of immune checkpoint blockade treatment.[16] In addition, JMJD6 interacts with RNA-binding motif protein 39 and targets diacylglycerol O-acyltransferase 1 to regulate lipid droplet formation and drive clear cell renal cell carcinoma tumorigenesis.[17] JMJD6 is also upregulated in hepatocellular carcinoma (HCC) tissues and is associated with poor outcome and aggressive characteristics, in which it promotes HCC proliferation and migration by targeting cyclin-dependent kinase 4.[18] JMJD6 is also critical to generate androgen receptor splice variant 7, which promotes prostate cancer growth.[19] Wong et al. found that JMJD6 interacts with N-Myc and bromodomain-containing 4 (BRD4) to promote the transcriptional activity of E2F transcription factor 2 (E2F2), N-Myc, and c-Myc, leading NB proliferation and survival.[20] However, the role of JMJD6 in the expansion of NB stem cells has not been reported. Therefore, here we tried to determine the effect and regulatory mechanisms of JMJD6 in NB stem cell expansion. Our findings indicated that JMJD6 promotes NB stem cell expansion by activating the WNT pathway.
MATERIAL AND METHODS
Cell culture and clinic samples
Normal human neuron (HN, cat. 1520) was purchased from the ScienCell Research Laboratories and maintained in accordance with the manufacturer’s instructions. The NB cells SKNDZ (cat. CRL-2149), SKNAS (cat. CRL-2137), BE2-M17 (cat. CRL-2267), SKNFI (cat. CRL-2142), IMR32 (cat. CCL-127), and SKNBE2 (cat. CRL-2271) were purchased from ATCC (Manassas, USA) and maintained in Dulbecco’s Modified Eagle Medium (cat. SH30249.01, Hyclone, Logan, UT, USA) added with 10% fetal bovine serum (cat. SH30406.05, Hyclone) at 37℃ in a humidified incubator set to 5% carbon dioxide. All cell lines underwent identity validation through short tandem repeat profiling and were confirmed to be mycoplasma-free before experimental use.
A cohort of 47 paraffin-embedded NB specimens were freshly collected from a hospital. Informed consent was obtained from all patients’ guardian before collection of neuroblastoma specimens. Specimen collection and all experiments were approved by the Institutional Review Board of First Affiliated Hospital of Sun Yat-sen University (No. 2021129). Tissue samples were collected from patients who had not received any previous local or systemic treatment before an operation. The study complies with the Helsinki Declaration (https://www.wma.net/policies-post/wma-declaration-of-helsinki/).
Quantitative polymerase chain reaction (q-PCR)
Total RNA was extracted from cells using Trizol reagent (cat. R701-02, Vazyme, Nanjing, China). Reverse transcription was carried out using a HiScript III 1st Strand complementary DNA Synthesis Kit (+Genomic DNA wiper, cat. R233, Vazyme) in accordance with the manufacturer’s instruction. All gene transcripts were quantified using AceQ Universal SYBR qPCR Master Mix (cat. Q511, Vazyme) on a LightCycle96 PCR system (Roche, Basel, Switzerland). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Gene expression fold changes were analyzed using the 2−ΔΔCt method to determine differential expression levels of target genes. The primers were expressed as follows: JMJD6, forward: 5' AGAAATGGACTCTGGAGCGC3', reverse: 5' GGGTGTTCACCATAGCTGCT3'; CD133, forward: 5' ACCTTGAAGAGCTTGCACCA3', reverse, 5' CACCAAGCACAGAGGGTCAT3'; BMI1, forward: 5' TGGACTGACAAATGCTGGAGA3', reverse: 5' CTGGGGCTAGGCAAACAAGA3'; KLF transcription factor 4 (KLF4), forward: 5' GCTGTGGATGGAAATTCGCC3', reverse: 5' CATGTGTAAGGCGAGGTGGT3'; ALDH1A, forward: 5' AGGGGCAGCCATTTCTTCTC3', reverse: 5' TTCCCGGCAGCTTCTTTGAT3'; ABCG2, forward: 5' TTCTGCCCAGGACTCAATGC3', reverse: 5' ATTCTTCCACAAGCCCCAGG3'; MYC, forward: 5' CATCAGCACAACTACGCAGC3', reverse: 5' CGTTGTGTGTTCGCCTCTTG3'; CD44, forward: 5' GAGCAGCACTTCAGGAGGTT3', reverse: 5' CTGTCTGTGCTGTCGGTGAT3'.
Western blot
Protein was extracted from cells using Radio-Immunoprecipitation Assay buffer supplemented with a protease inhibitor cocktail (cat. 11836170001, Sigma). The supernatant was collected after sonication and centrifugation; protein concentrations were quantified using a bicinchoninic acid assay kit (cat. 23227, Thermo, Waltham, MA, USA). For immunoblotting, protein samples were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels, followed by electrophoresis and transfer to a polyvinylidene fluoride membrane (cat. IPVH00010, Millipore, Darmstadt, Germany). The membranes were blocked using 5% non-fat milk and probed with the following primary antibodies: anti-JMJD6 antibody (1:1000, cat. 60602, CST, Danvers, MA, USA), anti-β-Catenin antibody (1:2000, cat. 8480, CST), anti-EF-1α antibody (1:2000, cat. sc-21758, Santa Cruz, Dallas, TX, USA), and anti-GAPDH antibody (1:10000, cat. 2118, CST). Then, the membranes were incubated with an horseradish peroxidase-conjugated second antibody (1:10000, cat. 7074, or 1:10000, cat. 7076, CST), and the bands were visualized with electrochemiluminescence luminescence (Bio-Rad, Hercules, CA, USA). Quantitative analysis was performed using Image J (https://imagej.net/ij/ index.html).
Generation of stably engineered cell lines
The coding sequence of JMJD6 was amplified using PCR and subcloned into lentivector pCDH-CMV-MCS-EF1-Puro (System Biosciences). The empty vector served as the negative control. Two shRNAs for JMJD6 were cloned into pLKO.1-Puro lentivector. Scrambled sequence served as a negative control. The lentivector, pM2.D, and pSPAX2 were co-transfected into 293FT using lipofectamine 2000 (cat. 11668019, Thermo). After 48 h, viral supernatants were collected and clarified by filtration. Lentiviruses were used to infect cells with 8 µg/mL polybrene (cat. TR-1003, Sigma, St. Louis, MO, USA). The infected cells were selected using 1 µg/mL puromycin (cat. HY-15695, MCE, NJ, USA). Small interfering RNA (siRNA) for LEF1 and TCF4 were purchased from RiboBio Inc. and transfected into cells using lipofectamine 3000 (cat. L3000015, Thermo). The Wnt pathway inhibitor PRI-724 was obtained from Selleck. It was used to treat NB cells with or without JMJD6 expression.
Sphere formation ability assay
Sphere formation assay was conducted in accordance with a previously reported method.[21] A total of 500 cells were seeded on six-well ultra-low cluster plates (cat. 3471, Corning, NY, USA) and cultured using NeuroCult NS-A Proliferation Kit (cat. 05751, Stemcell Technologies, Vancouver, BC, Canada) for 14 days. Then, spheres were photographed using an inverted microscope (DMi1, Leica, Germany) and counted.
Animal model
Female BALB/c nude mice aged 5–6 weeks (16–18 g) were anesthetized and subcutaneously injected with a different number of JMJD6-overexpressing cells and control cells. 1 × 103, 1 × 104, and 1 × 105 cells mixed with 50% Matrigel (cat. 354237, Corning) were injected into the right flank. The progression of tumors was closely observed, and the volume of each tumor was determined by applying the formula (length × width × height)/2. Once the tumor volume reached 1.0 cm3, the mice were humanely sacrificed through an injection of sodium pentobarbital, after which the tumors were harvested for further processing. All animal studies utilized mice maintained in SPF-grade environments under standardized conditions: 21°C–23°C ambient temperature, 50% humidity, a 14:10-h light-dark cycle, and unrestricted availability of feed and drinking water. The animal experiment was approved by the Animal Care and Ethics Committee of First Affiliated Hospital of Sun Yat-sen University.
Immunohistochemistry (IHC)
IHC of paraffin-embedded NB tissues was performed in accordance with a previously reported method.[22] Anti-JMJD6 was used at a dilution of 1:100. The staining intensity of JMJD6 was evaluated using the histochemical scoring (H-score) system, which was employed to assess the staining intensity and the proportion of positively stained cells. Regarding the staining intensity, a score ranging from 0 to 3 was assigned. Then, the percentage of positively stained cells corresponding to each intensity level was estimated. The H-score was computed as follows: 1 × the percentage of weakly stained cells + 2 × the percentage of moderately stained cells + 3 × the percentage of strongly stained cells. H <150 is considered as low expression, and H >150 is regarded as a high expression.
Luciferase reporter assay
A total of 3 × 105 cells/well were seeded at 24-well plates for cell transfection. TCF/LEF sites upstream of a luciferase reporter (TOP-Flash) and mutated TCF/LEF binding sites upstream of a luciferase reporter (FOP-Flash) plasmids were obtained from Addgene and co-transfected into the indicated cells using Lipofectamine 3000. After 48 h, the luciferase reporter assay was conducted in strict accordance with the guidelines provided by the manufacturer (Promega).
Statistical analysis
The Statistical Package for the Social Sciences 11.0 was used for statistical analysis. Statistical analyses were conducted using several methods. Fisher’s exact test, log-rank test, Chi-square test, and Student’s two-tailed t-test were used for appropriate evaluations. To determine the bivariate correlation among the study variables, Sperman’s rank correlation coefficients were calculated. Survival curves were generated using the Kaplan–Meier method. Then, these curves were compared using the log-rank test to assess the differences in survival patterns. The significance of different variables with regard to survival was analyzed through univariate and multivariate Cox regression analyses. The data were presented as mean ± standard deviation. With regard to statistical significance, P ≤ 0.05 were considered statistically significant.
RESULTS
JMJD6 is elevated in NB tissues and cells
To determine the role of JMJD6 in NB progression, its expression was examined in NB cells and tissues and in other kinds of tumor tissues, including prostate cancer and glioma. Our results indicated that JMJD6 was elevated in NB tissues (P < 0.05) [Figure 1a]. We compared JMJD6 expression in HN cells and NB cells (SKNDZ, SKNAS, BE2-M17, SKNFI, IMR32, and SKNBE2) and found that JMJD6 was significantly elevated in NB cells (P < 0.05), [Figure 1b]. Similarly, we compared JMJD6 expression in normal neuron tissues and NB tissues and confirmed that JMJD6 was significantly elevated in NB tissues (P < 0.05), [Figure 1c]. These findings confirmed that JMJD6 was elevated in NB cells and tissues.
- JMJD6 is elevated in NB tissues and cells. (a) RNA-seq analysis of JMJD6 expression in various tumors. JMJD6 expression in NB tissues serves as the control. ✶P < 0.05. (b) JMJD6 expression in normal HN cells and NB cells determined by q-PCR and Western blot assays. (c) JMJD6 expression in normal human neuroblastoma tissues and NB tissues determined by q-PCR and Western blot assays. Data were presented as mean ± SEM from three independent experiments, ✶P < 0.05. JMD6: Jumonji domain-containing, HN: Human neuroblastoma, NB: Neuroblastoma, q-PCR: Quantitative polymerase chain reaction, SEM: Standard error of the mean.
JMJD6 enhances NB stem cell expansion in vitro
To investigate the function of JMJD6 in NB progression, we overexpressed JMJD6 in two NB cell lines, IMR32 and SKNAS. Western blotting analysis confirmed that JMJD6 was elevated in cells infected with the JMJD6-overexpressing virus [Figure 2a]. CD133, KLF4, aldehyde dehydrogenase 1 family member A1 (ALDH1A1), ATP-binding cassette subfamily G member 2 (JR blood group, ABCG2), and B lymphoma MoMLV insertion region 1 homolog (BMI1) are markers for NB stem cells,[23-27] and they were significantly upregulated in cells overexpressing JMJD6 (P < 0.05), [Figure 2b]. The sphere formation assay showed that JMJD6 overexpression significantly promoted the volume and number of tumor spheres (P < 0.05), [Figure 2c]. These results indicated that JMJD6 overexpression enhanced the self-renewal of NB stem cells.
- JMJD6 overexpression promotes the expansion of NB in vitro. (a) Western blot analysis of JMJD6 level in JMJD6 overexpression stable cell lines. (b) q-PCR analysis of NB cancer stem cell maker levels in JMJD6-overexpressing cells. (c) Sphere formation analysis of the effect of JMJD6 overexpression on NB stem cell expansion. Scale bar, 50µm. Data were presented as mean ± SEM from three independent experiments, ✶P < 0.05. JMD6: Jumonji domain-containing, NB: Neuroblastoma, q-PCR: Quantitative polymerase chain reaction, SEM: Standard error of the mean.
To confirm the above findings, we downregulated JMJD6 in the same NB cell lines. Western blotting showed that JMJD6 silencing significantly inhibited JMJD6 expression [Figure 3a]. The expression levels of CD133, KLF4, ALDH1A1, ABCG2, and BMI1 were significantly downregulated after JMJD6 knockdown (P < 0.05), [Figure 3b]. Similarly, the sphere formation assay indicated that JMJD6 knockdown significantly decreased the volume and number of tumor spheres (P < 0.05), [Figure 3c]. These results indicated that JMJD6 increases the self-renewal of NB stem cells in vitro.
- JMJD6 knockdown suppresses NB stem cell expansion in vitro. (a) Western blot analysis of JMJD6 level in JMJD6 knockdown stable cell lines. (b) q-PCR analysis of NB cancer stem cell maker levels in JMJD6 knockdown cells. (c) Sphere formation analysis of the effect of JMJD6 knockdown on NB stem cell expansion. Scale bar, 50µm. Data were presented as mean ± SEM from three independent experiments, ✶P < 0.05. JMD6: Jumonji domain-containing, NB: Neuroblastoma, q-PCR: Quantitative polymerase chain reaction, SEM: Standard error of the mean.
JMJD6 promotes NB stem cell expansion in vivo
We confirmed the above results using a subcutaneously implanted tumor mouse model. We transplanted JMJD6-overexpressing IMR32 cells and vector-transformed control IMR32 cells into mice. JMJD6 overexpression significantly increased tumor growth; however, when the number of transplanted JMJD6-overexpressing cells was reduced, the tumor volume was decreased [Figure 4a and b]. In particular, when 1 × 103 JMJD6-overexpressing cells were transplanted into mice, tumors still grew; however, no tumor growth was observed when the same number of vector control cells were transplanted into mice [Figure 4c]. MYC and CD44 mRNA levels were also upregulated in xenograft tissues with JMJD6 overexpression [Figure 4d]. These results indicated that JMJD6 overexpression increased the frequency of tumor initiation.
- JMJD6 overexpression promotes the expansion of NB in vivo (n = 5). (a) Representative images of subcutaneous xenograft tumors were measured for JMJD6-overexpressing groups. (b) Tumor volumes of JMJD6-overexpressing subcutaneous xenograft tumors. (c) Engraftment rates of JMJD6 overexpressed in IMR32 cells. Data were presented as mean ± SEM from five independent experiments. (d) mRNA levels of JMJD6, MYC, and CD44 xenograft tissues with JMJD6 expression or vector control. JMD6: Jumonji domain-containing, NB: Neuroblastoma, SEM: Standard error of the mean, mRNA: Messenger RNA.
JMJD6 promotes NB stem cell expansion by activating the WNT pathway
To explain the regulatory mechanism of JMJD6 in NB stem cell expansion, GSEA was applied to analyze the signaling pathways regulated by JMJD6. We found that JMJD6 expression was positively correlated with the WNT3A pathway [Figure 5a], indicating that the WNT pathway might be the downstream pathway regulated by JMJD6. TOP/FOR luciferase reporter assays revealed that JMJD6 significantly enhanced luciferase activity, indicating that JMJD6 increased WNT pathway activity (P < 0.05), [Figure 5b]. Western blotting assays confirmed that JMJD6 promoted the nuclear translocation of β-catenin [Figure 5c]. We also determined the role of JMJD6 in the expression of WNT pathway downstream genes. The proteins encoded by these genes regulate the expansion of NB stem cells, such as CD44, MYC, TCF1 (encoding transcription factor 1), JUN, and CCND1 (encoding cyclin D1). Based on qRT-PCR assays, JMJD6 significantly promoted these gene levels (P < 0.05), [Figure 5d]. These results indicated that JMJD6 activates the WNT pathway.
- JMJD6 activates the WNT pathway in NB cells. (a) GSEA analysis of the correlation between JMJD6 expression and WNT pathway activity. (b) TOP/FOR analysis of the effect of JMJD6 on WNT pathway activity. (c) Western blot analysis of β-catenin expression in the nucleus once JMJD6 overexpression or knockdown. (d) q-PCR analysis of WNT pathway targets expression after JMJD6 overexpression or knockdown. Data were presented as mean ± SEM from three independent experiments, ✶P < 0.05. JMD6: Jumonji domain-containing, NB: Neuroblastoma, q-PCR: Quantitative polymerase chain reaction, SEM: Standard error of the mean.
To further confirm the above results, we inhibited the WNT pathway in JMJD6-overexpressing NB cells using siRNAs for LET1 and TCF4. The sphere formation assay also revealed that the inhibition of the WNT pathway in JMJD6-overexpressing cells suppressed the expansion of NB stem cells (P < 0.05), [Figure 6a]. These functional assays indicated that JMJD6 promotes NB stem cell expansion by activating the WNT pathway.
- JMJD6 promotes the expansion of NB stem cells by activating the WNT pathway. (a) Sphere formation analysis of the effect of WNT pathway inhibition on the expansion of NB stem cells in JMJD6-overexpressing cells. LEF1-siRNA, TCF4-siRNA, and PRI-724 were used to inhibit the WNT pathway. PRI-724 is an inhibitor for the WNT pathway. Scale bar, 50 µm. (b) JMJD6 expression analysis using RNA-seq data. Data were presented as mean ± SEM from three independent experiments, ✶P < 0.05, ✶✶P < 0.01. JMD6: Jumonji domain-containing, NB: Neuroblastoma, si-RNA: Small interfering RNA, SEM: Standard error of the mean.
JMJD6 is an independent poor prognostic factor for patients with NB
To analyze whether JMJD6 is a prognostic factor for patients with NB, we analyzed the level of JMJD6 in progressive NB tissues via published data and found that JMJD6 was significantly elevated in high-risk NB tissues compared with low-risk NB tissues. JMJD6 was also significantly upregulated in NB tissues in stages 3–4 compared with stages 1–2 [Figure 6b]. These results indicated that elevated JMJD6 expression level was associated with progressive NB.
We used IHC to analyze JMJD6 expression in a cohort of 47 NB patients [Figure 7a]. NB patients with high JMJD6 levels had poor overall survival and relapse-free survival compared with those with low JMJD6 expression [Figure 7b]. We determined the correlation between the JMJD6 level and the clinicopathological characteristics of patients with NB. JMJD6 levels correlated significantly with treatment response, relapse, and vital status, indicating that JMJD6 was associated with poor outcomes. Nevertheless, no substantial correlation was detected in relation to the other clinicopathological features, such as age, gender, and tumor–node–metastasis stage [Tables 1 and 2]. To determine whether JMJD6 was an independent prognostic factor for patients with NB, univariate and multivariate analyses were conducted, which revealed that JMJD6 expression was an independent prognostic factor for patients with NB [Table 3]. In summary, high JMJD6 levels indicate poor prognosis and survival for patients with NB.
- High JMJD6 expression is associated with NB pathogenesis. (a) IHC staining analysis of JMJD6 expression in NB tissues. Scale bar, 100µm. (b) Kaplan–Meier survival analyses of the influence of JMJD6 on overall- or disease-free survival. JMD6: Jumonji domain-containing, 6NB: Neuroblastoma, IHC: Immunohistochemistry.
| Characteristics | No. of cases |
|---|---|
| Age (years) | |
| ≤2 | 16 |
| >2 | 31 |
| Gender | |
| Male | 34 |
| Female | 13 |
| TNM stage | |
| III | 13 |
| IV | 34 |
| Treatment response | |
| PR/CR | 34 |
| SD/PD | 13 |
| Relapse | |
| Yes | 16 |
| No | 31 |
| Status (at follow-up) | |
| Alive | 37 |
| Death caused by neuroblastoma | 10 |
| Death caused by other diseases other than neuroblastoma | 0 |
| JMJD6 expression | |
| Negative | 0 |
| Positive | 47 |
| Low expression | 28 |
| High expression | 19 |
JMD6: Jumonji domain-containing 6, TNM: Tumor–node–metastasis, PR/CR: Partial response/complete response, SD/PD: Stable disease/progressive disease.
| Characteristics | JMJD6 | Chi-square test P-value | Fisher’s Exact test P-value | |
|---|---|---|---|---|
| Low no. | High no. | |||
| Age (years) | ||||
| ≤2 | 6 | 10 | 0.057 | 0.58 |
| >2 | 22 | 9 | ||
| Gender | ||||
| Male | 19 | 15 | 0.515 | 0.311 |
| Female | 9 | 4 | ||
| TNM | ||||
| III | 10 | 3 | 0.189 | 0.189 |
| IV | 18 | 16 | ||
| Treatment response | ||||
| PR/CR | 26 | 8 | 0.001 | 0.001 |
| SD/PD | 2 | 11 | ||
| Relapse | ||||
| Yes | 4 | 12 | 0.001 | 0.001 |
| No | 24 | 7 | ||
| Vital status | ||||
| Alive | 27 | 10 | 0.001 | 0.001 |
| Death | 1 | 9 | ||
JMD6: Jumonji domain-containing 6, TNM: Tumor–node–metastasis, PR/CR: Partial response/complete response, SD/PD: Stable disease/progressive disease.
| Univariate analysis | Multivariate analysis | |||||
|---|---|---|---|---|---|---|
| No. of patients | P | Relative risk | P | Relative risk | 95% confidence interval | |
| Expression of JMJD6 | ||||||
| Low expression | 28 | 0.001 | 14.208 | 0.012 | 14.208 | 1.771–113.986 |
| High expression | 19 | |||||
JMD6: Jumonji domain-containing 6
DISCUSSION
Based on the hypothesis of CSCs, conventional cancer therapy only kills bulk tumor cells without killing the CSCs. Killing CSCs might inhibit tumor regression over time, and combining an anti-CSC drug with chemotherapy might eradicate the tumor; therefore, identifying the targets for CSCs is important.[28,29] Here, we revealed that JMJD6 was elevated in NB cells and tissues, and patients with high JMJD6 levels had a poor outcome. We also identified JMJD6 as an independent prognostic factor for patients with NB. Functional analyses demonstrated that JMJD6 promotes NB stem cell expansion by activating the WNT pathway. Inactivation of the WNT pathway through siRNAs against LEF1, TCF4, or the WNT pathway inhibitor PRI-724 could effectively reverse the effects of JMJD6 overexpression on the expansion of NB stem cells.
Recently, another group also found that JMJD6 promotes NB proliferation, survival, and growth, indicating that JMJD6 also promotes bulk NB progression. They found that JMJD6 is an independent prognostic factor for patients with NB, which is consistent with our findings. They also found that MYC directly binds to JMJD6’s promoter to upregulate its transcription. Moreover, JMJD6 forms a complex with N-MYC and BRD4 to promote E2F2 and MYC expression, and E2F2 and MYC are important for NB progression. Moreover, JMJD6 is regulated by a super-enhancer. Using the super-enhancer inhibitor THZ1 or the histone deacetylase inhibitor panobinostat could inhibit MYC, JMJD6, and E2F2 expression to inhibit NB proliferation and growth.[20,30,31] However, they did not study the role of JMJD6 in NB stem cells. Herein, we found that JMJD6 also regulated the expansion bulk NB cells, indicating that JMJD6 was suitable for NB-targeted therapy. The molecular mechanism of JMJD6 in NB stem cells might be different from that in bulk NB cells. The WNT pathway is a fundamental signaling pathway for CSCs expansion, as demonstrated in various types of CSCs. JMJD6 regulates RNA splicing, and it is associated with translational pause release.[10,32] Apart from the Wnt pathway, JMJD6 has been reported to regulate other types of tumor progression through ferroptosis, STAT3/IL-10, and MAPK.[16,33,34] Whether JMJD6 regulates NB expansion through these pathways remains to be investigated.
SUMMARY
We found that JMJD6 might be a good target for NB therapy because it promotes not only bulk NB cell proliferation and growth but also NB stem cell expansion.
AVAILABILITY OF DATA AND MATERIALS
The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.
ABBREVIATIONS
FBS: Fetal bovine serum
HN: Normal human neuroblastoma
IHC: Immunohistochemistry
JMJD6: Jumonji domain-6 protein
NB: Neuroblastoma
siRNA: Small interfere RNA
AUTHOR CONTRIBUTIONS
JTX and ZX: Designed the study; ZQL, WZG, PFG, and YCF: Conducted the experiments; HDC and HJ: Performed the statistical analysis; ZX: Wrote the manuscript; and JTX: Helped to revise the manuscript. All authors read and approved of the final manuscript. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All experimental procedures in studies involving animals were in accordance with the ethical standards of the Institutions at which the studies were conducted and were approved by Institutional Animal Care and Use Committee of First Affiliated Hospital of Sun Yat-sen University (NO. 2021129). Prior consent and approval from the Institutional Research Ethics Committee were obtained for the use of these clinical materials for research purposes. Informed consent was obtained from all patients’ guardian before collection of neuroblastoma specimens. Specimens’ collection and all experiments were approved by the Institutional Review Board of the First Affiliated Hospital of Sun Yat-sen University. Tissue samples were collected from patients who had not received any previous local or systemic treatment before an operation (NO. 2021129). The study design adhered to the declaration of Helsinki.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: This work was supported by the Guangdong Basic and Applied Basic Research Foundation (No. 2022A1515010712).
References
- Neuroblastoma origin and therapeutic targets for immunotherapy. J Immunol Res. 2018;2018:7394268.
- [CrossRef] [PubMed] [Google Scholar]
- Neuroblastoma: Molecular pathogenesis and therapy. Annu Rev Med. 2015;66:49-63.
- [CrossRef] [PubMed] [Google Scholar]
- Cancer stem cells: Models and concepts. Annu Rev Med. 2007;58:267-84.
- [CrossRef] [PubMed] [Google Scholar]
- Cancer stem cells: At the headwaters of tumor development. Annu Rev Pathol. 2007;2:175-89.
- [CrossRef] [PubMed] [Google Scholar]
- Neuroblastoma stem cells-mechanisms of chemoresistance and histone deacetylase inhibitors. Neoplasma. 2012;59:737-46.
- [CrossRef] [PubMed] [Google Scholar]
- Human neuroblastoma stem cells. Semin Cancer Biol. 2007;17:241-7.
- [CrossRef] [PubMed] [Google Scholar]
- Wnt signaling is a major determinant of neuroblastoma cell lineages. Front Mol Neurosci. 2019;12:90.
- [CrossRef] [PubMed] [Google Scholar]
- Cancer stem cells in neuroblastoma: Expanding the therapeutic frontier. Front Mol Neurosci. 2019;12:131.
- [CrossRef] [PubMed] [Google Scholar]
- Jumonji domain-containing protein 6 (jmjd6) is required for angiogenic sprouting and regulates splicing of VEGF-receptor 1. Proc Natl Acad Sci U S A. 2011;108:3276-81.
- [CrossRef] [PubMed] [Google Scholar]
- Jmjd6 catalyses lysyl-hydroxylation of U2AF65, a protein associated with RNA splicing. Science. 2009;325:90-3.
- [CrossRef] [PubMed] [Google Scholar]
- Jumonji domain containing protein 6 (jmjd6) modulates splicing and specifically interacts with arginine-serine-rich (RS) domains of SR-and SR-like proteins. Nucleic Acids Res. 2014;42:7833-50.
- [CrossRef] [PubMed] [Google Scholar]
- Jumonji domain-containing protein 6 protein and its role in cancer. Cell Prolif. 2020;53:e12747.
- [CrossRef] [PubMed] [Google Scholar]
- Role of JMJD6 in breast tumourigenesis. PLoS One. 2015;10:e0126181.
- [CrossRef] [PubMed] [Google Scholar]
- JMJD6 is a driver of cellular proliferation and motility and a marker of poor prognosis in breast cancer. Breast Cancer Res. 2012;14:R85.
- [CrossRef] [PubMed] [Google Scholar]
- JMJD6 regulates histone H2A.X phosphorylation and promotes autophagy in triple-negative breast cancer cells via a novel tyrosine kinase activity. Oncogene. 2019;38:980-97.
- [CrossRef] [PubMed] [Google Scholar]
- JMJD6 in tumor-associated macrophage regulates macrophage polarization and cancer progression via STAT3/IL-10 axis. Oncogene. 2023;42:2737-50.
- [CrossRef] [PubMed] [Google Scholar]
- An oncogenic JMJD6-DGAT1 axis tunes the epigenetic regulation of lipid droplet formation in clear cell renal cell carcinoma. Mol Cell. 2022;82:3030-44.e8.
- [CrossRef] [PubMed] [Google Scholar]
- JMJD6 promotes hepatocellular carcinoma carcinogenesis by targeting CDK4. Int J Cancer. 2019;144:2489-500.
- [CrossRef] [PubMed] [Google Scholar]
- JMJD6 is a druggable oxygenase that regulates AR-V7 expression in prostate cancer. Cancer Res. 2021;81:1087-100.
- [CrossRef] [PubMed] [Google Scholar]
- JMJD6 is a tumorigenic factor and therapeutic target in neuroblastoma. Nat Commun. 2019;10:3319.
- [CrossRef] [PubMed] [Google Scholar]
- A hierarchy of self-renewing tumor-initiating cell types in glioblastoma. Cancer Cell. 2010;17:362-75.
- [CrossRef] [PubMed] [Google Scholar]
- Microenvironment in neuroblastoma: Isolation and characterization of tumor-derived mesenchymal stromal cells. BMC Cancer. 2018;18:1176.
- [CrossRef] [PubMed] [Google Scholar]
- CD133 suppresses neuroblastoma cell differentiation via signal pathway modification. Oncogene. 2011;30:97-105.
- [CrossRef] [PubMed] [Google Scholar]
- Aldehyde dehydrogenase activity plays a key role in the aggressive phenotype of neuroblastoma. BMC Cancer. 2016;16:781.
- [CrossRef] [PubMed] [Google Scholar]
- ABC transporters and neuroblastoma. Adv Cancer Res. 2015;125:139-70.
- [CrossRef] [PubMed] [Google Scholar]
- Role of stemness-related molecules in neuroblastoma. Pediatr Res. 2012;71:511-5.
- [CrossRef] [PubMed] [Google Scholar]
- Understanding the cancer stem cell. Br J Cancer. 2010;103:439-45.
- [CrossRef] [PubMed] [Google Scholar]
- The therapeutic promise of the cancer stem cell concept. J Clin Invest. 2010;120:41-50.
- [CrossRef] [PubMed] [Google Scholar]
- ASCL1 is a MYCN-and LMO1-dependent member of the adrenergic neuroblastoma core regulatory circuitry. Nat Commun. 2019;10:5622.
- [CrossRef] [PubMed] [Google Scholar]
- HAUSP deubiquitinates and stabilizes N-Myc in neuroblastoma. Nat Med. 2016;22:1180-6.
- [CrossRef] [PubMed] [Google Scholar]
- Brd4 and JMJD6-associated anti-pause enhancers in regulation of transcriptional pause release. Cell. 2013;155:1581-95.
- [CrossRef] [PubMed] [Google Scholar]
- JMJD6 promotes melanoma carcinogenesis through regulation of the alternative splicing of PAK1, a key MAPK signaling component. Mol Cancer. 2017;16:175.
- [CrossRef] [PubMed] [Google Scholar]
- JMJD6 K375 acetylation restrains lung cancer progression by enhancing METTL14/m6A/SLC3A2 axis mediated cell ferroptosis. J Transl Med. 2025;23:233.
- [CrossRef] [PubMed] [Google Scholar]