Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Filter by Categories
Abstracts
Book Review
Case Report
Case Series
CMAS‡ - Pancreas - EUS-FNA Cytopathology (PSC guidelines) S1:1 of 5
CMAS‡ - Pancreas - EUS-FNA Cytopathology (PSC guidelines) S1:3 of 5
CMAS‡ - Pancreas - EUS-FNA Cytopathology (PSC guidelines) S1:4 of 5
CMAS‡ - Pancreas -Sampling Techniques for Cytopathology (PSC guidelines) S1:2 of 5
CMAS‡ - Pancreas- EUS-FNA Cytopathology (PSC guidelines) S1:5 of 5
Commentary
Correction
CytoJournal Monograph Related Review Series
CytoJournal Monograph Related Review Series (CMAS), Editorial
CytoJournal Monograph Related Review Series: Editorial
Cytojournal Quiz Case
Editorial
Erratum
Letter to Editor
Letter to the Editor
Letters to Editor
Methodology
Methodology Article
Methodology Articles
Original Article
Pap Smear Collection and Preparation: Key Points
Quiz Case
Research
Research Article
Review
Review Article
Systematic Review and Meta Analysis
View Point
View/Download PDF

Translate this page into:

Research Article
2025
:22;
59
doi:
10.25259/Cytojournal_57_2025

Mechanism of 15-hydroxyprostaglandin dehydrogenase protein inhibiting cervical cancer cell proliferation through downregulation of the notch1 signaling pathway

Department of Gynaecology, Yuhuangding Hospital, Yantai, China.
Author image
Corresponding author: Suwen Chang, Department of Gynaecology, Yuhuangding Hospital, Yantai, China. csw529@126.com
Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

How to cite this article: Chang S. Mechanism of 15-hydroxyprostaglandin dehydrogenase protein inhibiting cervical cancer cell proliferation through downregulation of the notch1 signaling pathway. CytoJournal. 2025;22:59. doi: 10.25259/Cytojournal_57_2025

Abstract

Objective:

This study aims to explore the modulatory effect of 15-hydroxyprostaglandin dehydrogenase (15-PGDH) protein in the Notch1 signaling pathway in cervical cancer (CC) cells and assess how this modulation affects the proliferation and migration of CC cells. Moreover, this study offers fresh perspectives on the molecular mechanisms underlying CC by thoroughly analyzing the relationship between 15-PGDH and the Notch1 signaling pathway, and investigates the therapeutic potential of 15-PGDH.

Material and Methods:

Human normal cervical epithelial cells and CC cell lines (human CC cell line [HeLa], human cervical squamous carcinoma cell line [Caski], and human cervical epidermoid carcinoma cells [ME180]) were selected as experimental models. Western blotting (WB) and quantitative reverse transcription polymerase chain reaction were performed to evaluate the protein and messenger RNA levels of 15-PGDH and Notch receptor 1 (Notch1) signaling pathway-related proteins (Jagged canonical Notch ligand 1 [Jagged1] and Hes family bHLH transcription factor 1 [Hes1]). Results suggested that the HeLa and Caski cells exhibited significant expression of 15-PGDH and Notch1 signaling-related proteins. A series of experiments, including WB, cell counting kit-8 assay, Transwell migration assay, and 5-ethynyl-2'-deoxyuridine assay, was conducted in the HeLa and Caski cells to obtain an extensive understanding of how 15-PGDH influences Notch1 signaling regulation. This study also utilized the 15-PGDH inhibitor SW033291 and a Notch1 overexpression vector to evaluate the effect of 15-PGDH on CC cell growth, motility, and Notch1 signaling pathway modulation.

Results:

Results demonstrated that in the normal human cervical epithelial cells, 15-PGDH was highly expressed, while the Notch1 signaling pathway-related proteins exhibited low expression quantities. However, in HeLa and Caski CC cells, 15-PGDH expression was significantly downregulated (P < 0.001 or P < 0.01), whereas the Notch1 signaling pathway was activated. Further studies revealed that 15-PGDH or its inhibitor influenced the stimulation of the Notch1 signaling pathway in the HeLa and Caski cells. Specifically, the 15-PGDH inhibitor SW033291 reduced 15-PGDH expression (P < 0.001 or P < 0.01) and promoted Notch signaling activation. Meanwhile, 15-PGDH upregulation suppressed Notch signaling activation. Furthermore, 15-PGDH successfully prevented the proliferation and migration of CC cells induced by Notch1 overexpression and reduced the activation of the Notch signaling pathway, as shown by the downregulation of Notch1 and its downstream effectors, Jagged1 and Hes1.

Conclusion:

This study highlights the role of 15-PGDH in regulating the Notch1 signaling pathway in CC cells, focusing on its effect on cell proliferation and migration. The results demonstrate that 15-PGDH suppresses CC cell proliferation and migration by downregulating the Notch1 signaling pathway. These findings provide new insights into the molecular mechanisms underlying CC and suggest 15-PGDH as a promising therapeutic target.

Keywords

15-Hydroxyprostaglandin dehydrogenase
Cervical cancer
Migration
Notch1 signaling pathway
Proliferation

INTRODUCTION

Cervical cancer (CC) ranks among the four most prevalent cancers in women globally,[1] characterized by high incidence and mortality rates.[2] The data from the World Health Organization indicated that roughly 604,000 new instances of CC were reported globally in 2020, which resulted in around 342,000 deaths.[3] In 2022, an estimated 660,000 women were diagnosed with CC worldwide, and approximately 350, 000 women died from the disease. This form of cancer arises in cervix, the lower section of the uterus that connects to the vagina. CC usually starts with abnormal cell changes in the cervix, which are frequently caused by infections with high-risk strains of human papillomavirus (HPV). If these abnormal cells are not timely intervened, then they may gradually progress into CC over time.[4] Current treatment strategies for CC include radiation therapy, chemotherapy, and surgery.[5-7] Although these approaches are considered effective to a certain extent, they inevitably lead to significant adverse effects and are frequently unable to fully halt the spread of cancer.[8] In addition, the biological characteristics and potential molecular mechanisms of CC remain to be further elucidated. Therefore, an investigation of other effective prevention and treatment strategies for CC is urgently needed.

15-Hydroxyprostaglandin dehydrogenase (15-PGDH) has been established as a key factor in inhibiting the growth of various malignancies, including gastrointestinal cancers,[9] bladder cancer,[10] and lung cancer.[11] Prostaglandins are essential in driving tumor progression by modulating critical biological processes, including angiogenesis, cell movement, invasion, growth, and programmed cell death.[12] 15-PGDH, a core enzyme in the prostaglandin metabolic pathway,[13] fine-tunes the biological availability of prostaglandins by converting them into biologically inactive metabolites, namely, 13,14-dihydro-15-keto-PGF2 and 13,14-trihydro-15-keto-prostaglandin E2 (PGE2). 15-PGDH ensures the proper balance of prostaglandins through this enzymatic process, thereby influencing various physiological and pathological processes, including inflammation, tissue homeostasis, and tumor progression. Moreover, 15-PGDH can suppress the activity of prostaglandin-endoperoxide synthase 2,[14] an essential regulatory point in the biosynthesis of prostaglandins from arachidonic acid.[15] Although the association between 15-PGDH and various malignancies is well established,[16,17] its potential role in CC remains underexplored, warranting further investigation.

The Notch signaling pathway is a system that remains remarkably consistent across different species, exerting a crucial influence on the regulation of diverse physiological processes, encompassing cell proliferation, differentiation, viability, and apoptosis, which is a form programmed cell death.[18] This pathway consists of the Notch receptor (Notch) transmembrane receptor family (Notch1 to Notch4) and their corresponding ligands (delta-like 1, 3, 4, and Jagged canonical Notch ligand 1 [Jagged1], Jagged2).[19,20] Notch receptors are single-span membrane proteins that consist of an extracellular region, a membrane-spanning segment, and an intracellular portion. When ligands from adjacent cells interact with the receptor, the Notch signaling pathway is triggered, resulting in the γ-secretase-mediated cleavage of the Notch1 receptor and the release of its notch intracellular domain (NICD).[21] Thereafter, the NICD moves into the nucleus, where it associates with specific transcription factor complexes to regulate the transcription of genes that are implicated in various cellular processes. These genes include those belonging to the hairy/enhancer of split (Hes) and hairy/enhancer of split-related with YRPW motif (Hey) families.[22] This modulation of gene expression has a profound influence on biological processes, such as cell differentiation, proliferation, and apoptosis, which is a type of programmed cell death. Research has indicated that the Notch pathway is frequently dysregulated in various cancers, including CC, resulting in enhanced tumor cell growth and survival.[23] In recent years, an increasing number of studies have demonstrated that the Notch1 signaling pathway plays a crucial role in the initiation and progression of CC. Aberrant activation of the Notch1 signaling pathway can promote the proliferation, migration, and invasion of CC cells while inhibiting apoptosis, thereby accelerating the progression of CC.[24,25] However, the function of 15-PGDH, an essential enzyme involved in prostaglandin metabolism, in tumors is still poorly understood. Current studies indicate that 15-PGDH may suppress the growth and division of cancer cells by modulating prostaglandin concentrations. However, the exact function of 15-PGDH in the modulation of the Notch1 signaling pathway remains to be fully elucidated. Further research is needed to determine whether 15-PGDH directly influences Notch1 activity or exerts its effects through indirect regulatory mechanisms. This study aims to investigate the biological functions of 15-PGDH in CC cell proliferation and its molecular mechanisms, with a focus on whether 15-PGDH inhibits CC cell proliferation by downregulating the Notch1 signaling pathway, providing new insights for targeted therapy in CC.

This study focuses on the pivotal role of 15-PGDH protein in regulating CC cell proliferation, particularly investigating whether it exerts inhibitory effects through downregulation of the Notch1 signaling pathway. Although 15-PGDH, a key enzyme in prostaglandin metabolism, is widely involved in inflammation regulation and tumor suppression, its precise mechanism in CC remains to be fully understood. Accordingly, this study seeks to explore the involvement of 15-PGDH in the progression of CC, concentrating primarily on how it regulates the Notch1 pathway and influences the proliferation of CC cells. This study may provide new theoretical support and potential targets for molecular therapy in CC by revealing the mechanisms through which 15-PGDH regulates the Notch1 signaling pathway in CC progression.

MATERIAL AND METHODS

Cell culture

Human normal cervical epithelial cells (HcerEpiC), human CC cells (Henrietta Lacks cells, HeLa), human cervical squamous carcinoma cells (Caski), and human cervical epidermoid carcinoma cells (ME180) were purchased from Pricella Biotechnology Co., Ltd. (catalog numbers: CP-H059, CL-0101, CL-0048, and CL-0155, Wuhan, China). The HcerEpiC and ME180 cells were cultured in Roswell Park Memorial Institute 1640 medium (12633020, Gibco, Grand Island, NY, USA), while the HeLa and Caski cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) (12491015, Gibco, Grand Island, NY, USA). Both culture media were supplemented with 10% fetal bovine serum (FBS) (10099141C, Gibco, Grand Island, NY, USA), along with penicillin (100 U/mL) and streptomycin (100 μg/mL) (P7630, Solarbio, Beijing, China). All cells were maintained in a 37°C incubator with 5% carbon dioxide (CO2) and high humidity. The identity of all cell lines was confirmed using short tandem repeat genotyping, and all were confirmed to be free from mycoplasma contamination.

Cell interventions and grouping

The HeLa and Caski cells were cultured in DMEM medium containing 10% FBS, penicillin (100 U/mL), and streptomycin (100 μg/mL) at 37°C with 5% CO2 to examine the influence of 15-PGDH protein and its inhibitor SW033291 on the activation of the Notch receptor (Notch) signaling pathway in these cells. The cells were divided into three groups: Control group: Cells were treated with solvent only (no intervention); SW033291 inhibitor group: Cells were treated with 0.1 mM SW033291 (HY-16968, MedChem Express, Monmouth Junction, NJ, USA) and cultured for 24 h; and 15-PGDH group: Cells were treated with 10 μg/mL of 15-PGDH protein (HY-P75547A, MedChem Express, Monmouth Junction, NJ, USA) and cultured for 24 h. Subsequently, the HeLa and Caski cells were categorized into four groups to comprehensively assess the influence of 15-PGDH protein on Notch1 overexpression-induced CC cell proliferation and Notch activation: Control group; 15-PGDH group; Notch1-OE group: Notch1 gene overexpression was induced in the HeLa and Caski cells through lentiviral-mediated gene transfection, and the cells were cultured for 48 h (the full-length Notch1 overexpression plasmid was provided by Guangzhou Ruibo Biotechnology Co., Ltd. Cell transfection was performed using Lipofectamine™ 3000 reagent [18324010, Thermo Fisher, MA, USA]); and Notch1-OE+15-PGDH group: cells were co-treated with Notch1 overexpression (through lentiviral transfection) and 10 μg/mL of 15-PGDH protein for 24 h. After treatment, the cells were harvested for subsequent experimental analysis.

Western blotting (WB)

After treatment, the cells were lysed with radioimmunoprecipitation assay buffer (P0013C, Beyotime, Shanghai, China). The protein levels were measured with the bicinchoninic acid protein assay kit (P0012, Beyotime, Shanghai, China). Thereafter, the proteins were separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane. After 2 h of blocking, the membrane was incubated with primary antibodies overnight: 15-PGDH (1:1,000 dilution, PA5-82205, Thermo Fisher, Waltham, MA, USA), Notch1 (1:1,000 dilution, GB111690-100, Proteintech, Wuhan, China), Jagged1 (1:1,000 dilution, PA5-72843, Thermo Fisher, Waltham, MA, USA), Hes family bHLH transcription factor 1 (Hes1) (1:1,000 dilution, GB112254-100, Proteintech, Wuhan, China), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1,000 dilution, TA-08, ZSGB-BIO, Beijing, China). After a 2 h incubation with an HRP-conjugated secondary antibody (1:2,000 dilution, ZB-2305, ZSGB-BIO, Beijing, China) at room temperature (RT), the protein bands were visualized using an enhanced chemiluminescence system (Tanon-4600, Yuanping Hao Biotechnology, Beijing, China) and quantified with ImageJ software (V1.46; National Institutes of Health, USA).

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

After the cell treatment, the total RNA was isolated using the TRNzol Universal Total RNA extraction reagent (DP424, TIANGEN, Beijing, China). Subsequently, the extracted RNA was reverse transcribed into complementary DNA using a reverse transcription kit (KR116, TIANGEN, Beijing, China). Specific primers were used for PCR amplification on a real-time fluorescent quantitative PCR instrument (LightCycler96, Roche, Switzerland). GAPDH was used as an internal reference. The results were quantified using the 2−ΔΔCT method. The sequences of the primers are provided in Table 1.

Table 1: Primer information.
Gene Primer sequences (5'–3')
15-PGDH F: CTCTGTTCATCCAGTGCGAT
R: TCACTCCAGCATTATTGACCA
GAPDH F: AAGGTCATCCATGACAAC
R: AGGCAGGGATGATGTTCT

15-PGDH: 15-hydroxyprostaglandin dehydrogenase, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine

Cell counting kit-8 (CCK-8) assay

The survival rate of the HeLa and Caski cells was evaluated utilizing the CCK-8 kit (C0038, Beyotime, Shanghai, China). The cells were plated at 1 × 103/well in 96-well plates. At specified times, 10 μL of CCK-8 was added to each well, and the plates were incubated for 3 h. The viability was assessed by measuring the absorbance at 490 nm with a microplate spectrophotometer (CMaxPlus, MOLECULAR DEVICES, USA). Each group included at least three wells, and the experiment was repeated at least three times.

Transwell migration assay

The HeLa and Caski cells (1 × 105 cells/mL) were resuspended in serum-free media and placed in the Transwell upper chamber (3422, BRAND, DE). The lower chamber had 10% FBS media. The cells were incubated at 37°C, 5% CO2 for 12 h. Post-incubation, inserts were fixed with 4% paraformaldehyde (PFA) (P0099, Beyotime, Shanghai, China) for 10 min at RT and stained with 0.5% crystal violet (C0121, Beyotime, Shanghai, China) for 20 min at RT. The migrated cells were counted with an inverted microscope (XD-202, Jiangnan, Nanjing, China).

5-Ethynyl-2'-deoxyuridine (EdU) Assay

The EdU kit (G1601, Servicebio, Wuhan, China) was used to assess cell proliferation. Briefly, the HeLa and Caski cells were plated at 5 × 104 cells/well in 24-well plates and treated with 50 μM EdU for 4 h at 37°C. After treatment, the cells were fixed with 4% PFA for 10 min at RT, permeabilized with 0.5% Triton X-100 (T8200, Solarbio, Beijing, China) for 5 min, and nuclei stained with 4',6-diamidino-2-phenylindole (C0060, Solarbio, Beijing, China). The cells were visualized with a fluorescence microscope (CKX53, OLYMPUS, Tokyo, Japan), and the percentage of EdU-positive cells was calculated to evaluate cell proliferation.

Cysteine-dependent aspartate-directed proteases (Caspase) activity assay

Apoptotic pathway analysis was conducted by measuring the activities of caspase -3, -8, and -9 using specific assay kits (catalog numbers: G015-1-3, G017-1-3, and G018-1-3; Nanjing Jiancheng, Nanjing, China). The HeLa and Caski cells (6 × 103 cells/well) were seeded into 96-well plates. At the indicated time points, 100 μL of the corresponding caspase -3, -8, or -9 reagent was added to each well. The plate was shaken for 30 s and incubated at room temperature for 1 h. Thereafter, the caspase activity was quantified by measuring absorbance at 490 nm with a multifunctional microplate reader (CMaxPlus, MOLECULAR DEVICES, USA).

Statistical analysis

Statistical analysis was conducted using GraphPad Prism (version 9.5, GraphPad Software, La Jolla, California, USA). T-tests were used for two-group comparisons, and one-way analysis of variance for multiple groups, with Tukey’s post hoc test. The results are reported as means ± standard deviation, with significance at P < 0.05.

RESULTS

Low expression of 15-PGDH and activation of the notch1 signaling pathway in human CC cells

WB and qRT-PCR assays were performed to explore the expression of 15-PGDH and proteins associated with the Notch1 signaling pathway in CC cells and HcerEpiC. The HcerEpiC cells exhibited relatively high expression of 15-PGDH protein [Figure 1], while the expression of Notch1, Jagged1, and Hes1 proteins was comparatively low [Figure 1a-e]. This result suggests that 15-PGDH may maintain homeostasis in normal cervical epithelial cells by inhibiting the activation of the Notch signaling pathway, preventing abnormal proliferation or tumorigenesis. In comparison with the HcerEpiC cells, 15-PGDH protein expression was notably lower in the HeLa, Caski, and ME180 cells, showing a low expression status [Figure 1a and b] (P < 0.001 or P < 0.01). Meanwhile, the expression of Notch1, Jagged1, and Hes1 proteins showed a significant increase [Figure 1a, c-e] (P < 0.01 or P < 0.05), indicating that the Notch1 signaling pathway was activated in the HeLa and Caski CC cells. The qRT-PCR experiment revealed that the messenger RNA expression of 15-PGDH across the four cell lines was consistent with the WB results [Figure 1f]. These experimental findings not only validate the hypothesis of low expression of 15-PGDH and induction of Notch1 pathway activation in human CC cells but also provide important evidence for further exploration of the pathogenesis of CC and the identification of potential therapeutic targets.

15-PGDH downregulation and activation of the Notch1 signaling pathway in human CC cells. (a) WB analysis of the expression levels of 15-PGDH and Notch1 signaling pathway-related proteins in HcerEpiC and CC cells (HeLa, Caski, ME180). (b-e) Quantitative analysis of the protein levels of 15-PGDH and Notch1 signaling pathway-related proteins. (f) RT-qPCR analysis of 15-PGDH messenger RNA levels in the cells. n = 3, ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001 versus HcerEpiC. HcerEpiC: Human cervical epithelial cells, HeLa: Henrietta Lacks cells, Caski: Cervical squamous carcinoma cells, ME180: Human cervical epidermoid carcinoma cells, 15-PGDH: 15-hydroxyprostaglandin dehydrogenase, Notch1: Notch receptor 1, Jagged1: Jagged canonical Notch ligand 1, Hes1: Hes family bHLH transcription factor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, CC: Cervical cancer, WB: Western blotting.
Figure 1:
15-PGDH downregulation and activation of the Notch1 signaling pathway in human CC cells. (a) WB analysis of the expression levels of 15-PGDH and Notch1 signaling pathway-related proteins in HcerEpiC and CC cells (HeLa, Caski, ME180). (b-e) Quantitative analysis of the protein levels of 15-PGDH and Notch1 signaling pathway-related proteins. (f) RT-qPCR analysis of 15-PGDH messenger RNA levels in the cells. n = 3, P < 0.05, P < 0.01, P < 0.001 versus HcerEpiC. HcerEpiC: Human cervical epithelial cells, HeLa: Henrietta Lacks cells, Caski: Cervical squamous carcinoma cells, ME180: Human cervical epidermoid carcinoma cells, 15-PGDH: 15-hydroxyprostaglandin dehydrogenase, Notch1: Notch receptor 1, Jagged1: Jagged canonical Notch ligand 1, Hes1: Hes family bHLH transcription factor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, CC: Cervical cancer, WB: Western blotting.

15-PGDH protein or its inhibitor modulates notch1 signaling pathway activation in HeLa and Caski cells

WB analysis was performed to assess the expression of key proteins, including 15-PGDH, Notch1, Jagged1, and Hes1, and examine whether 15-PGDH protein and its inhibitor influence the activation of the Notch1 signaling pathway in HeLa and Caski cells. The results show that in the Control group, the expression levels of 15-PGDH, Notch1, Jagged1, and Hes1 proteins in HeLa and Caski cells remained at baseline levels [Figure 2a-j]. However, when the 15-PGDH inhibitor SW033291 was added, a marked decrease in 15-PGDH protein levels was detected (P < 0.001), while the expression of Notch1, Jagged1, and Hes1 proteins was elevated (P < 0.001). This change suggests that SW033291, as an inhibitor of 15-PGDH, not only effectively inhibits the expression of 15-PGDH but also promotes the activation of the Notch signaling pathway [Figure 2a-j]. By contrast, the group treated with 15-PGDH exhibited a marked increase in 15-PGDH protein expression (P < 0.001), while the amounts of Notch1 protein and its downstream target proteins Jagged1 and Hes1 were downregulated [Figure 2a-j]. This observation implies that 15-PGDH may have a role in downregulating the Notch signaling pathway. Overall, the experimental results provide preliminary evidence that 15-PGDH protein and its inhibitor play important roles in regulating Notch signaling pathway activation in HeLa and Caski cells.

Effect of 15-PGDH protein or its inhibitor on Notch1 signaling pathway activation in HeLa and Caski Cells. (a) WB assessment of 15-PGDH and Notch1 pathway proteins expression in HeLa cells. (b-e) Quantitative assessment of 15-PGDH and Notch1 pathway proteins amounts in HeLa cells. (f) WB assessment of 15-PGDH and Notch1 pathway proteins expression in Caski cells. (g-j) Quantitative assessment of 15-PGDH and Notch1 pathway proteins amounts in Caski cells. n = 3, ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001 versus control. HeLa: Henrietta Lacks cells, Caski: Cervical squamous carcinoma cells, 15-PGDH: 15-hydroxyprostaglandin dehydrogenase, Notch1: Notch receptor 1, Jagged1: Jagged canonical Notch ligand 1, Hes1: Hes family bHLH transcription factor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, WB: Western blotting.
Figure 2:
Effect of 15-PGDH protein or its inhibitor on Notch1 signaling pathway activation in HeLa and Caski Cells. (a) WB assessment of 15-PGDH and Notch1 pathway proteins expression in HeLa cells. (b-e) Quantitative assessment of 15-PGDH and Notch1 pathway proteins amounts in HeLa cells. (f) WB assessment of 15-PGDH and Notch1 pathway proteins expression in Caski cells. (g-j) Quantitative assessment of 15-PGDH and Notch1 pathway proteins amounts in Caski cells. n = 3, P < 0.05, P < 0.01, P < 0.001 versus control. HeLa: Henrietta Lacks cells, Caski: Cervical squamous carcinoma cells, 15-PGDH: 15-hydroxyprostaglandin dehydrogenase, Notch1: Notch receptor 1, Jagged1: Jagged canonical Notch ligand 1, Hes1: Hes family bHLH transcription factor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, WB: Western blotting.

15-PGDH protein inhibits notch1 overexpression-induced cc cell proliferation

WB was initially performed to assess the Notch1 protein levels in HeLa and Caski cells and examine the influence of 15-PGDH on Notch1 overexpression-induced CC cell proliferation. The results demonstrated that Notch1 protein expression remained relatively stable at baseline in the Control group [Figure 3a and b]. However, the expression was significantly higher in the Notch1-OE group compared with the Control group (P < 0.001). Subsequently, the effects of 15-PGDH protein on Notch1 overexpression-induced CC cell proliferation were examined through CCK-8, Transwell migration, and EdU assays. The CCK-8 assay demonstrated that the cells in the Notch1-OE group proliferated at a significantly higher rate than those in the Control group, indicating that Notch1 overexpression promotes CC cell proliferation. By contrast, cell proliferation in the 15-PGDH group was reduced, and the Notch1-OE+15-PGDH group exhibited a markedly slower proliferation rate than the Notch1-OE group (P < 0.001). These findings indicate that 15-PGDH protein exerts an inhibitory effect on cell proliferation driven by Notch1 overexpression [Figure 3c and d].

15-PGDH protein inhibits Notch1 overexpression-induced proliferation of HeLa and Caski cells. (a) WB analysis of Notch1 overexpression in HeLa and Caski cells. (b) Quantitative assessment of Notch1 overexpression abundance in HeLa and Caski cells. (c and d) CCK-8 assay to detect the proliferation of HeLa and Caski cells. (e) Transwell migration assay to assess the migration ability of HeLa and Caski cells. Magnification: ×200, scale bar: 50 μm. (f and g) Statistical outcomes of the Transwell migration test. (h) EdU assay analysis of the HeLa cell proliferation rate. Magnification: ×200, scale bar: 50 μm. (i) Statistical analysis of the EdU-positive rate in HeLa cells. (j) EdU assay analysis of the Caski cell proliferation rate. Magnification: ×200, scale bar: 50 μm. (k) Statistical analysis of the EdU-positive rate in Caski cells. (l and m) Caspase activity in HeLa and Caski cells was detected using a caspase assay kit. n = 3, ✶✶P < 0.01 and ✶✶✶P < 0.001 versus Control; ###P < 0.001 versus 15-PGDH; ^^P < 0.01 and ^^^P < 0.001 versus Notch1-OE. HeLa: Henrietta Lacks cells, Caski: cervical squamous carcinoma cells, 15-PGDH: 15-hydroxyprostaglandin dehydrogenase, Notch1: Notch receptor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, EdU: 5-ethynyl-2’-deoxyuridine, DAPI: 4',6-diamidino-2-phenylindole, Caspase-3: Cysteine-aspartic protease 3, Caspase-8: Cysteine-aspartic protease 8, and Caspase-9: Cysteine-aspartic protease 9, WB: Western blotting, CCK-8: Cell counting kit-8.
Figure 3:
15-PGDH protein inhibits Notch1 overexpression-induced proliferation of HeLa and Caski cells. (a) WB analysis of Notch1 overexpression in HeLa and Caski cells. (b) Quantitative assessment of Notch1 overexpression abundance in HeLa and Caski cells. (c and d) CCK-8 assay to detect the proliferation of HeLa and Caski cells. (e) Transwell migration assay to assess the migration ability of HeLa and Caski cells. Magnification: ×200, scale bar: 50 μm. (f and g) Statistical outcomes of the Transwell migration test. (h) EdU assay analysis of the HeLa cell proliferation rate. Magnification: ×200, scale bar: 50 μm. (i) Statistical analysis of the EdU-positive rate in HeLa cells. (j) EdU assay analysis of the Caski cell proliferation rate. Magnification: ×200, scale bar: 50 μm. (k) Statistical analysis of the EdU-positive rate in Caski cells. (l and m) Caspase activity in HeLa and Caski cells was detected using a caspase assay kit. n = 3, P < 0.01 and P < 0.001 versus Control; ###P < 0.001 versus 15-PGDH; ^^P < 0.01 and ^^^P < 0.001 versus Notch1-OE. HeLa: Henrietta Lacks cells, Caski: cervical squamous carcinoma cells, 15-PGDH: 15-hydroxyprostaglandin dehydrogenase, Notch1: Notch receptor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, EdU: 5-ethynyl-2’-deoxyuridine, DAPI: 4',6-diamidino-2-phenylindole, Caspase-3: Cysteine-aspartic protease 3, Caspase-8: Cysteine-aspartic protease 8, and Caspase-9: Cysteine-aspartic protease 9, WB: Western blotting, CCK-8: Cell counting kit-8.

The Transwell migration assay further revealed that the cell migration in the Notch1-OE group was markedly enhanced compared with that of the control group (P < 0.001). However, the migration capacity was reduced in the 15-PGDH group. In addition, the Notch1-OE+15-PGDH group exhibited lower migration ability than the Notch1-OE group, suggesting that 15-PGDH protein suppresses Notch1 overexpression-induced CC cell migration [Figure 3e-g]. Moreover, the results of the EdU assay also supported these conclusions, further confirming that 15-PGDH protein can inhibit Notch1 overexpression-induced CC cell proliferation [Figure 3h-k]. The Caspase activity assays [Figure 3l and m] demonstrated that treatment with 15-PGDH significantly enhanced the activity of Caspase-3, -8, and -9 and reversed the decrease in Caspase activity induced by Notch1 overexpression. This notion suggests that the pro-apoptotic effect of 15-PGDH is closely related to the inhibition of the Notch1 pathway. In summary, these experimental results suggest that 15-PGDH protein can inhibit Notch1 overexpression-induced cell proliferation and migration in CC cells. Therefore, 15-PGDH may play a critical regulatory role in modulating Notch1-driven oncogenic behaviors, highlighting its potential as a therapeutic target for CC treatment.

15-PGDH protein inhibits notch1 overexpression-induced notch activation

WB analysis was conducted to examine the involvement of 15-PGDH protein in Notch signaling regulation by measuring the expression levels of 15-PGDH, Notch1, Jagged1, and Hes1 in HeLa and Caski cells. The findings demonstrated that in the Control group, 15-PGDH protein remained at a stable baseline level, while Notch1, Jagged1, and Hes1 protein expressions were higher [Figure 4]. In the Notch1-OE group, the expression of 15-PGDH protein was reduced, while the levels of Notch1, Jagged1, and Hes1 proteins were not significantly upregulated compared with the Control group [Figure 4]. Relative to the Control group, the 15-PGDH group showed a marked increase in 15-PGDH protein expression (P < 0.001). Furthermore, the protein expression of Notch1 and its downstream signaling molecules Jagged1 and Hes1 was notably decreased (P < 0.001), indicating that the upregulation of 15-PGDH inhibits Notch signaling pathway activation [Figure 4]. In the Notch1-OE+15-PGDH group, although Notch1 was overexpressed, the 15-PGDH protein levels were significantly increased, while Notch1, Jagged1, and Hes1 protein expression was markedly less than in the Notch1-OE group (P < 0.001). This notion suggests that 15-PGDH inhibits Notch signaling pathway activation induced by Notch1 overexpression [Figure 4]. In summary, 15-PGDH protein expression effectively represses Notch1 pathway activation and downregulates Jagged1 and Hes1. This finding suggests that 15-PGDH may exert a suppressive effect in CC cells by downregulating the Notch1 signaling pathway.

15-PGDH protein inhibits Notch activation induced by Notch1 overexpression in HeLa and Caski cells. (a) WB analysis of 15-PGDH and proteins associated with the Notch1 pathway in HeLa cells. (b-e) Quantitative assessment of 15-PGDH and Notch1 pathway-related proteins expression levels. (f) WB analysis of 15-PGDH and proteins associated with the Notch1 pathway in Caski cells. (g-j) Quantitative assessment of 15-PGDH and Notch1 pathway-related protein expression levels. n = 3, ✶✶✶P < 0.001 versus Control; ###P < 0.001 versus 15-PGDH; ^^^P < 0.001 versus Notch1-OE. HeLa: Henrietta Lacks Cells, Caski: Cervical squamous carcinoma cells, 15-PGDH: 15-hydroxyprostaglandin dehydrogenase, Notch1: Notch receptor 1, Jagged1: Jagged canonical Notch ligand 1, Hes1: Hes family bHLH transcription factor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, WB: Western blotting.
Figure 4:
15-PGDH protein inhibits Notch activation induced by Notch1 overexpression in HeLa and Caski cells. (a) WB analysis of 15-PGDH and proteins associated with the Notch1 pathway in HeLa cells. (b-e) Quantitative assessment of 15-PGDH and Notch1 pathway-related proteins expression levels. (f) WB analysis of 15-PGDH and proteins associated with the Notch1 pathway in Caski cells. (g-j) Quantitative assessment of 15-PGDH and Notch1 pathway-related protein expression levels. n = 3, P < 0.001 versus Control; ###P < 0.001 versus 15-PGDH; ^^^P < 0.001 versus Notch1-OE. HeLa: Henrietta Lacks Cells, Caski: Cervical squamous carcinoma cells, 15-PGDH: 15-hydroxyprostaglandin dehydrogenase, Notch1: Notch receptor 1, Jagged1: Jagged canonical Notch ligand 1, Hes1: Hes family bHLH transcription factor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, WB: Western blotting.

DISCUSSION

CC is a predominant form of cancer that affects the cervix, primarily resulting from persistent infection with high-risk strains of HPV.[26] Although conventional treatments, including radiotherapy, chemotherapy, and surgical intervention,[5-7] remain the primary approaches for cancer management, they are not without limitations and challenges. Issues, such as therapy resistance, adverse side effects, and the risk of recurrence, hinder the overall effectiveness of these treatments. Accordingly, exploring novel therapeutic strategies is essential to improve patient outcomes and enhance treatment efficacy. In recent years, 15-PGDH, an essential enzyme, has gained widespread attention due to its significant inhibitory effects in various cancers.[27]

15-PGDH, a crucial player in prostaglandin degradation, facilitates the oxidation of 15-hydroxyprostaglandins (PGs) into 15-keto prostaglandins, thereby producing metabolites that are biologically inactive. This action effectively opposes the function of Cyclooxygenase-2, which contributes to the formation of prostaglandins.[13] 15-PGDH is crucial in the progression of inflammation conditions, fibrosis diseases, and cancer-related ailments.[27-30] In a murine model of pulmonary fibrosis, the expression of 15-PGDH was significantly elevated in both epithelial cells, which line the surfaces of organs, and endothelial cells, which are part of the blood vessel lining.[31] 15-PGDH, functioning as a tumor suppressor, not only degrades PGs that promote tumors in cancer cells but also inhibits the transcriptional activity of the transcription factor glioma-associated oncogene homolog 1, inducing differentiation in colon cancer cells.[9] Furthermore, suppression of 15-PGDH stimulates the proliferation of KRAS-driven pancreatic tumor cells.[32] These discoveries offer solid proof that highlights the encouraging therapeutic prospects and potential of 15-PGDH in the management of cancer. This study used the 15-PGDH inhibitor SW033291, a potent and high-affinity inhibitor known to significantly elevate PGE2 levels and promote tissue regeneration, to explore the mechanisms by which 15-PGDH exerts its effects in CC cells. The results revealed that either the 15-PGDH protein itself or its specific inhibitor exerts a substantial regulatory substantial on the activation of the Notch signaling pathway within HeLa and Caski cells (P < 0.001).

The Notch signaling pathway is an essential and phylogenetically preserved mechanism that regulates essential physiological functions, including cell proliferation, differentiation, survival, and programmed cell death.[33] Studies have shown that Notch1 dissociates from the primary ciliary negative regulators, transforming into its activated form and migrating to the nucleus.[34] The process of Notch1 translocating to the nucleus stimulates the transcription and expression of downstream oncogene genes, including cyclin D1 and the homeobox transcription factor NANOG.[35] Notch1 has been recognized as an oncogene factor that is often overexpressed across various cancer types, including non-small cell lung cancer, breast cancer, hepatocellular carcinoma (HCC or liver cancer), gastric cancer, and CC.[36-40] This study found that 15-PGDH protein significantly inhibits the overexpression of Notch1, thereby suppressing the proliferation and migration of CC cells (P < 0.001). In addition, 15-PGDH exhibited an inhibitory effect on the activation of the Notch signaling pathway. Further analysis revealed a negative correlation between the expression level of 15-PGDH and the expression levels of Notch1 signaling-related proteins in HeLa and Caski cells, further confirming the regulatory role of 15-PGDH in modulating the Notch1 signaling pathway. When the Notch1 pathway was downregulated by 15-PGDH, the cell proliferation and migration induced by Notch1 overexpression were significantly suppressed (P < 0.001). Mechanistically, the inhibitory effect of 15-PGDH on Notch1 activation may be associated with its negative regulation of upstream ligands of Notch1 (such as Jagged1) and its suppression of downstream transcriptional targets (such as Hes1), which are critical mediators in the Notch1 signaling cascade. Furthermore, the experimental data showed that treatment with the 15-PGDH inhibitor SW033291 promoted Notch1 signaling activation and enhanced the motility of CC cells, while the expression of 15-PGDH reversed these effects. These findings suggest that 15-PGDH may exert its tumor-suppressive function by interfering with the classical Notch1 signaling axis, thereby slowing cancer progression and reducing metastatic potential.

In summary, this study offers initial insights into the crucial function of 15-PGDH in CC cells: it effectively inhibits CC cell proliferation and migration by downregulating Notch1 signaling pathway activation. This discovery provides new insights into the molecular mechanism underlying CC and highlights the potential of 15-PGDH as a promising therapeutic target. By elucidating its regulatory role, this research lays the groundwork for future studies focused on creating targeted therapies that leverage 15-PGDH regulation to hinder the progression of CC. Nonetheless, the study has some limitations. Future research will further validate these findings using animal models, along with analyzing public databases or increasing immunohistochemistry data from CC patient tissues, to evaluate their potential application in CC treatment. Although this study mainly focused on the regulatory role of 15-PGDH in the Notch1 signaling pathway, the potential association between 15-PGDH expression and HPV infection also warrants further investigation, as HPV is a key etiological factor in CC. Exploring this correlation may provide further insights into the role of 15-PGDH in CC pathogenesis and its clinical relevance.

SUMMARY

This study demonstrates that 15-PGDH protein suppresses the proliferation and migration of CC cells through downregulating the Notch1 signaling pathway, providing a novel approach and theoretical basis for CC diagnosis and treatment. 15-PGDH holds promise as a novel therapeutic target for CC, bringing fresh hope to patients.

AVAILABILITY OF DATA AND MATERIALS

The data that support the findings of this study are available from the corresponding author on reasonable request.

ABBREVIATIONS

15-PGDH: 15-hydroxyprostaglandin dehydrogenase

Caski: Human cervical squamous carcinoma cell line

Caspase: Cysteine-dependent Aspartate-directed Proteases

Caspase-3: Cysteine-aspartic protease 3

Caspase-8: Cysteine-aspartic protease 8

Caspase-9: Cysteine-aspartic protease 9

CC: Cervical cancer

CCK-8: Cell counting kit-8

COX-2: Cyclooxygenase-2

DAPI: 4',6-diamidino-2-phenylindole

DMEM: Dulbecco’s Modified Eagle Medium

EdU: 5-ethynyl-2'-deoxyuridine

GAPDH: Glyceraldehyde-3-phosphate dehydrogenase

GLI1: Glioma-associated oncogene homolog 1

HCC: Hepatocellular carcinoma

HcerEpiC: Human normal cervical epithelial cells

HeLa: Human cervical cancer cell line

Hes1: Hes family bHLH transcription factor 1

Hey: Hairy/enhancer of split-related with YRPW motif

HPV: Human papillomavirus

Jagged1: Jagged canonical Notch ligand 1

ME180: Human cervical epidermoid carcinoma cells

NICD: Notch intracellular domain

Notch: Notch receptor

Notch1: Notch receptor 1

PFA: Paraformaldehyde

PGE2: Prostaglandin E2

PGs: 15-hydroxyprostaglandins

qRT-PCR: Quantitative Reverse Transcription Polymerase Chain Reaction

RPMI: Roswell Park Memorial Institute

RT: Room temperature

WB: Western blotting

AUTHOR CONTRIBUTIONS

SWC: Conceived and designed the study; SWC: Responsible for data acquisition; SWC: Analyzed and interpreted the data; SWC: Responsible for experiments; SWC drafted the first version of the manuscript; and SWC: Critically revised the manuscript. SWC: Read and approved of the final manuscript. The author meets ICMJE authorship requirements.

ACKNOWLEDGMENT

Not applicable.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

Ethical approval and consent to participate is not required as this study did not involve human participants, animal subjects, or identifiable personal data. All experiments were conducted using commercially available cell lines, which do not require ethical approval or informed consent.

CONFLICT OF INTEREST

The author declares no conflict of interest.

EDITORIAL/PEER REVIEW

To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.

FUNDING: The author received no financial support for the research, authorship, or publication of this article.

References

  1. , , , , , , et al. Overexpression of C1orf74 predicts poor outcome and promote cervical cancer progression. Heliyon. 2024;10:e40966.
    [CrossRef] [PubMed] [Google Scholar]
  2. , , , , , , et al. circAMOTL1 motivates AMOTL1 expression to facilitate cervical cancer growth. Mol Ther Nucleic Acids. 2020;19:50-60.
    [CrossRef] [PubMed] [Google Scholar]
  3. . Assessing cancer screening disparities using secondary surveys: Challenges and opportunities. Innov Aging. 2022;6:148.
    [CrossRef] [Google Scholar]
  4. , , , . Correlation between human papillomavirus viral load and cervical lesions classification: A review of current research. Front Med (Lausanne). 2023;10:1111269.
    [CrossRef] [PubMed] [Google Scholar]
  5. , , , , , , et al. Long-term oncological outcome in patients with cervical cancer after 3 trimodality treatment (radiotherapy, platinum-based chemotherapy, and robotic surgery) Medicine (Baltimore). 2021;100:e25271.
    [CrossRef] [PubMed] [Google Scholar]
  6. , , , , , . Immune infiltration could predict the efficacy of short-term radiotherapy in patients with cervical cancer. Clin Transl Oncol. 2023;25:1353-67.
    [CrossRef] [PubMed] [Google Scholar]
  7. , , , , , , et al. Cervical cancer: A new era. Int J Gynecol Cancer. 2024;34:1946-70.
    [CrossRef] [PubMed] [Google Scholar]
  8. , , , . A comprehensive review of genistein's effects in preclinical models of cervical cancer. Cancers (Basel). 2023;16:35.
    [CrossRef] [PubMed] [Google Scholar]
  9. , , , , , , et al. Tumour suppressor 15-hydroxyprostaglandin dehydrogenase induces differentiation in colon cancer via GLI1 inhibition. Oncogenesis. 2020;9:74.
    [CrossRef] [PubMed] [Google Scholar]
  10. , , , , , , et al. The first case of primary hypertrophic osteoarthropathy with soft tissue giant tumors caused by HPGD loss-of-function mutation. Endocr Connect. 2019;8:736-44.
    [CrossRef] [PubMed] [Google Scholar]
  11. , , . Overexpression of 15-hydroxyprostaglandin dehydrogenase inhibits A549 lung adenocarcinoma cell growth via inducing cell cycle arrest and inhibiting epithelial-mesenchymal transition. Cancer Manag Res. 2021;13:8887-900.
    [CrossRef] [PubMed] [Google Scholar]
  12. , , , , , , et al. Physiological and pathological levels of prostaglandin E2 in renal parenchyma and neoplastic renal tissue. Prostaglandins Other Lipid Mediat. 2019;141:11-3.
    [CrossRef] [PubMed] [Google Scholar]
  13. , , , , , , et al. Recent advances in studies of 15-PGDH as a key enzyme for the degradation of prostaglandins. Int Immunopharmacol. 2021;101:108176.
    [CrossRef] [PubMed] [Google Scholar]
  14. , , , , . Prostaglandin E2 pathway is dysregulated in gastric adenocarcinoma in a Caucasian population. Int J Mol Sci. 2020;21:7680.
    [CrossRef] [PubMed] [Google Scholar]
  15. , , , , , . Molecular mechanism of prostaglandin endoperoxide H synthase 2 (PGHS2) inhibition by nitroarachidonic acid. Free Radical Biol Med. 2022;192:34.
    [CrossRef] [Google Scholar]
  16. , , , , , , et al. Epigenetic silencing of 15-hydroxyprostaglandin dehydrogenase by histone methyltransferase EHMT2/G9a in cholangiocarcinoma. Mol Cancer Res. 2022;20:350-60.
    [CrossRef] [PubMed] [Google Scholar]
  17. , , , , , , et al. Tumor microenvironmental 15-PGDH depletion promotes fibrotic tumor formation and angiogenesis in pancreatic cancer. Cancer Sci. 2022;113:3579-92.
    [CrossRef] [PubMed] [Google Scholar]
  18. , , , , , . Identifications of three novel alleles of serrate in Drosophila. Cells Dev. 2024;177:203908.
    [CrossRef] [PubMed] [Google Scholar]
  19. , , , , . Notch signaling and targeted therapy in non-small cell lung cancer. Cancer Lett. 2024;585:216647.
    [CrossRef] [PubMed] [Google Scholar]
  20. , , , , , , et al. Notch signaling pathway in cancer: From mechanistic insights to targeted therapies. Signal Transduct Target Ther. 2024;9:128.
    [CrossRef] [PubMed] [Google Scholar]
  21. , , , , , , et al. A spatiotemporal notch interaction map from plasma membrane to nucleus. Sci Signal. 2023;16:eadg6474.
    [CrossRef] [PubMed] [Google Scholar]
  22. , . Developing RNA-Seq and ChIP-Seq pipelines on an oxford nanopore technologies platform to study notch1 transcriptional dynamics. FASEB J. 2022;36:R3635.
    [CrossRef] [Google Scholar]
  23. , , , , . The notch signaling pathway contributes to angiogenesis and tumor immunity in breast cancer. Breast Cancer (Dove Med Press). 2022;14:291-309.
    [CrossRef] [PubMed] [Google Scholar]
  24. , , , . LncRNA HOXA-AS2 activates the notch pathway to promote cervical cancer cell proliferation and migration. Reprod Sci. 2021;28:3000-9.
    [CrossRef] [PubMed] [Google Scholar]
  25. , , , , , , et al. Jagged1 contained in MSC-derived small extracellular vesicles promotes squamous differentiation of cervical cancer by activating NOTCH pathway. J Cancer Res Clin Oncol. 2023;149:18093-102.
    [CrossRef] [PubMed] [Google Scholar]
  26. , , , , . Cervicovaginal microbiota: A promising direction for prevention and treatment in cervical cancer. Infect Agent Cancer. 2024;19:13.
    [CrossRef] [PubMed] [Google Scholar]
  27. , , , , , , et al. The tumor suppressor role and epigenetic regulation of 15-hydroxyprostaglandin dehydrogenase (15-PGDH) in cancer and tumor microenvironment (TME) Pharmacol Ther. 2025;268:108826.
    [CrossRef] [PubMed] [Google Scholar]
  28. , , , . Inhibition of prostaglandin-degrading enzyme 15-PGDH mitigates acute murine lung allograft rejection. Lung. 2023;201:591-601.
    [CrossRef] [PubMed] [Google Scholar]
  29. , , . Inhibition of 15-PGDH by SW033291 ameliorates age-related heart failure in mice. Exp Gerontol. 2025;202:112710.
    [CrossRef] [PubMed] [Google Scholar]
  30. . 15-pgdh inhibition alternatively activates macrophages to promote hematopoietic function during aging. Blood. 2023;142:5610.
    [CrossRef] [Google Scholar]
  31. , , , , , , et al. Therapeutic targeting of 15-PGDH in murine pulmonary fibrosis. Sci Rep. 2020;10:11657.
    [CrossRef] [PubMed] [Google Scholar]
  32. , , , , , , et al. Inhibition of 15-PGDH causes kras-driven tumor expansion through prostaglandin E2-ALDH1 signaling in the pancreas. Oncogene. 2019;38:1211-24.
    [CrossRef] [PubMed] [Google Scholar]
  33. , , , . Notch1 in cancer therapy: Possible clinical implications and challenges. Mol Pharmacol. 2020;98:559-76.
    [CrossRef] [PubMed] [Google Scholar]
  34. , , , , , , et al. AKT1-mediated NOTCH1 phosphorylation promotes gastric cancer progression via targeted regulation of IRS-1 transcription. J Cancer Res Clin Oncol. 2024;151:15.
    [CrossRef] [PubMed] [Google Scholar]
  35. , , , . Knockdown of sirtuin6 positively regulates acetylation of DNMT1 to inhibit NOTCH signaling pathway in non-small cell lung cancer cell lines. Cell Signal. 2023;105:110629.
    [CrossRef] [PubMed] [Google Scholar]
  36. , , , , , . FOXP3 facilitates the invasion and metastasis of non-small cell lung cancer cells through regulating VEGF, EMT and the Notch1/Hes1 pathway. Exp Ther Med. 2021;22:958.
    [CrossRef] [PubMed] [Google Scholar]
  37. , , , . Inhibition of notch1 increases paclitaxel sensitivity to human breast cancer. Chin Med J (Engl). 2024;127:442-7.
    [CrossRef] [Google Scholar]
  38. , . Two faces of NOTCH1 in liver cancer and immunotherapy. Cancer Discov. 2025;15:452-4.
    [CrossRef] [PubMed] [Google Scholar]
  39. , , , , , , et al. Notch1 signaling pathway promotes growth and metastasis of gastric cancer via modulating CDH5. Aging (Albany NY). 2024;16:11893-903.
    [CrossRef] [PubMed] [Google Scholar]
  40. , , , , , . Curcuminoid PBPD induces cuproptosis and endoplasmic reticulum stress in cervical cancer via the Notch1/RBP-J/NRF2/FDX1 pathway. Mol Carcinog. 2024;63:1449-66.
    [CrossRef] [PubMed] [Google Scholar]
Show Sections