Translate this page into:
Melanocortin 1 receptor alleviates collagen-induced arthritis by upregulating T helper 1/T helper 17 cells and downregulating regulatory T cells

Peng Su

Longbin Bai
*Corresponding authors: Peng Su Department of Hand & Foot and Reconstructive Microsurgery, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, China. supeng1324@163.com
Longbin Bai, Department of Hand & Foot and Reconstructive Microsurgery, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, China. sdslbailb@163.com
-
Received: ,
Accepted: ,
How to cite this article: Su B, Cheng L, Meng F, Yan H, Su P, Bai L. Melanocortin 1 receptor alleviates collagen-induced arthritis by upregulating T helper 1/T helper 17 cells and downregulating regulatory T cells. CytoJournal. 2026;23:4. doi: 10.25259/Cytojournal_16_2025
Abstract
Objective:
Arthritis is a common chronic disease. The T cell subpopulation, as a key element in the immune system, plays a crucial role in arthritis. This work aimed to explore the involvement of melanocortin 1 receptor (MC1R) in collagen-induced arthritis (CIA) and how it affects the balance of proinflammatory and anti-inflammatory T cell subsets.
Material and Methods:
Using flow cytometry, the ratios of T helper (Th)1, Th17, and regulatory T (Treg) cells were examined. Using the enzyme-linked immunosorbent assay, pro-interleukin (IL)-17, interferon (IFN)-g, anti-IL-10, and IL-4 were measured.
Results:
MC1R knockout (MC1R-KO) mice exhibited an increase in the proportion of Th1 and Th17 cells compared with wild-type mice. The proportion of Treg cells in MC1R-KO mice was reduced. The levels of IL-17 and IFN-g in MC1R-KO mice increased, whereas those of IL-10 and IL-4 decreased.
Conclusion:
MC1R-KO mice exacerbated CIA by upregulating the numbers of Th1 and Th17 cells and decreasing the proportion of Treg cells. The increased production of IL-17 and IFN-g, along with the reduced IL-10 and IL-4 levels, further contributed to the enhanced inflammatory response. These findings suggest that MC1R plays a crucial role in the regulation of immune responses and inflammation in CIA. Targeting MC1R may have therapeutic potential for autoimmune diseases characterized by dysregulated T cell subsets.
Keywords
Collagen-induced arthritis
Melanocortin 1 receptor
T cell
Th1 cells
Th17 cells
INTRODUCTION
Rheumatoid arthritis (RA) causes remarkable disability and reduces the quality of life for those affected.[1] The pathophysiology of RA is complicated, involving interactions between environmental, genetic, and immunological variables.[2] A key factor in the onset and progression of RA is immune system dysregulation, specifically with regard to T cell subsets.[3,4]
By producing and activating other immune cells, T cells play a crucial role in the adaptive immune response and aid in the pathophysiology of RA.[5] The equilibrium between pro-inflammatory and anti-inflammatory T cell subsets is essential for immune homeostasis and preventing severe inflammation.[6] These T cell subsets are out of balance in RA, with an increase in pro-inflammatory T cells, including T helper (Th)1 and Th17 cells, and a fall in regulatory T (Treg) cells.[2,7] Th1 cells are characterized by the production of interferon (IFN)-g and play a significant role in cell-mediated immunity.[8] Meanwhile, the production of interleukin (IL)-17 by Th17 cells contributes to tissue inflammation and neutrophil recruitment.[9,10] Treg cells, which are distinguished by the expression of the transcription factor forkhead box protein P3 (Foxp3), are in charge of preserving immunological tolerance and reducing overreactions.[11-13]
Melanocortin 1 receptor (MC1R) is a transmembrane G protein-coupled receptor (GPCR) primarily expressed in melanocytes, and it is present in other cell types, including certain immune cells.[14,15] MC1R interacts with melanocortins, such as a-melanocyte-stimulating hormone, to activate adenylyl cyclase, thereby increasing intracellular cyclic adenosine monophosphate levels and regulating various biological effects.[16,17] Research on MC1R has predominantly focused on pigmentation and skin cancer, but recent studies have highlighted its role in immune regulation.[18-21] Notably, studies on inflammatory diseases suggest that MC1R may modulate immune cell functions and participate in the regulation of immune responses.[22-24] In the context of RA pathogenesis, the role of MC1R remains inadequately understood. However, some studies indicate that MC1R may influence immune cell functions and play a significant role in the development of RA.[25,26] Investigating the role of MC1R in a collagen-induced arthritis (CIA) model can provide crucial insights into its potential role in RA.
This study aimed to investigate the function of MC1R in RA immune modulation through the development of an MC1R deletion CIA mouse model. By examining the proportions of Th1, Th17, and Treg cells and their associated cytokines, this work aimed to analyze the effect of MC1R knockout on the immune mechanisms of RA. The importance of studying MC1R’s role in RA lies in two main aspects: First, it could enhance the understanding of the immune mechanisms underlying RA, revealing the role of MC1R in balancing Th1/ Th17 and Treg cells. Second, it offers new therapeutic avenues for RA, suggesting that MC1R could become a novel target for RA treatment, with the development of MC1R-based immunomodulators holding important clinical potential.
MATERIAL AND METHODS
Experimental animals
Twenty wild-type (WT) C57BL/6 mice and 30 MC1R transgenic mice (C57BL/6J, Cya-Mc1rem1/Cya, S-KO-03149, Cyagen [Suzhou] Biotechnology Co., Ltd.) were bred at the University. The mice weighed approximately 20 g. The mouse feeding conditions were as follows: 12 h of light and dark cycle at 23°C ± 1°C and free food and water. The MC1R knockout (MC1R-KO) + stattic group was intraperitoneally injected with 5 mg/kg of stattic (HY-13818, MedChemExpress, Monmouth County, NJ, USA) once every 2 days.[27] At the end of the experiments, the mice were euthanized by intraperitoneal injection of 1% sodium pentobarbital (100 mg/kg, Shandong Xiya Chemical Industry Co., Ltd., Shandong, China). Death was confirmed by the absence of heartbeat and breathing for at least 5 min. All procedures were performed in accordance with the institutional guidelines for animal care and use of Laboratory Animals of Shandong Provincial Hospital, affiliated to Shandong First Medical University.
Establishment of CIA mouse model
Chicken type II collagen (20021, Chondrex, Inc., Redmond, WA, USA) was mixed and emulsified with complete Freund’s adjuvant (F5881, Sigma–Aldrich, St. Louis, MO, USA) on ice. For the primary immunization, the mice’s tail roots received a subcutaneous injection of the emulsified collagen and complete Freund’s adjuvant. A second immunization was performed 21 days later. On day 28, the mice developed redness and swelling in the joints, indicating successful modeling.[28-30]
2,4-Dinitrofluorobenzene (DNFB)-induced mouse delayed-type hypersensitivity (DTH)
The abdominal area of each mouse was depilated with 8% sodium sulfide (407410, Sigma–Aldrich, St. Louis, MO, USA), with an area of 3 cm × 3 cm. On the 3rd day, 50 μL of 1% DNFB (D1529, Sigma–Aldrich, St. Louis, MO, USA) acetone olive oil solution was evenly applied to the depilated area of the skin. The same dose was reinforced on the 6th day. Except for the blank control group, the other mice were intraperitoneally injected with cyclophosphamide (HY-17420, MedChemExpress, Monmouth County, NJ, USA) at a dose of 50 mg/kg on the 5th, 6th, and 7th days. On the 9th day, 20 μL of 1% DNFB acetone olive oil solution was evenly applied to both sides of the mouse’s right ear.
Counting of different cell types
White blood cells were first counted on a cell counting plate (BS-QT-1103, Biosharp, Hubei, China). Then, they were diluted ×20 with 3% acetic acid and methylene blue (M8030, Solarbio, Beijing, China). Blood samples were prepared for blood smears. They were stained, washed, and dried by Pappenheim method and examined for oil immersion under the microscope (Zeiss imager Z2 VivaTome, Oberkochen, Baden-Wurttemberg, Germany). In each smear, techniques were performed on the cells, and on the basis of cell morphology, the cells were divided into neutrophils, lymphocytes, and monocytes. The absolute number of these cells was calculated on the basis of the total number of white blood cells.[31]
Hematoxylin and eosin staining of pathological changes in mouse ankle synovium
The mouse ankle joints were fixed in 4% paraformaldehyde (P0099, Beyotime Biotechnology, Shanghai, China) for 48 h. Decalcification was then performed using 10% ethylenediaminetetraacetic acid (C0196, Beyotime Biotechnology, Shanghai, China) solution until tissue resistance was no longer felt when pierced with a needle. The decalcified tissue was placed in a dehydration box and dehydrated, embedded, and sectioned using a graded ethanol series. The sections were dewaxed to hydration, stained with Mayer’s hematoxylin (H9627, Merk, Darmstadt, Germany) to stain the cell nucleus, and counterstained with eosin (C0109, Beyotime Biotechnology, Shanghai, China) to stain the cytoplasm. After being dehydrated and sealed, the sections were observed under a microscope (BX51, Olympus Corporation, Tokyo, Japan) and scored for histopathology.[32]
Arthritis index (AI) scoring
After the initial immunization, the number of arthritic paws in each group of mice was recorded every 3 days, and the severity of each arthritic paw was scored. The maximum AI score was 16 points, and the severity of redness in the limbs was scored from 1 point to 4 points: 0 point indicated no redness; 1 point indicated slight redness; 2 points indicated moderate redness; 3 points indicated obvious redness in the entire paw; and 4 points indicated redness in the entire paw, accompanied by joint deformity and impaired movement. An AI score of ≥1 point indicated successful modeling.[33]
Enzyme-linked immunosorbent assay (ELISA) detection of serum factors
Serum factors were determined in accordance with the ELISA kit’s recommendations. Following the kit’s instructions, samples were added, the plate was incubated for 1 h at 37°C, the liquid was disposed of, and three washes were performed. After an enzyme-labeled reagent was added to each well, the plate was rinsed 5 times under identical reaction conditions. After adding substrate to each well, the plate was covered and incubated for 15 min at 37°C in a dark environment. Finally, a stop solution was added, and the optical density was immediately measured using an ELISA reader (SpectraMax M5 microplate reader, Molecular Devices, CA, USA), with three repetitions and the average value taken. IL-17 (DY421), IFN-g (DY485), IL-10 (DY417), IL-4 (DY404), tumor necrosis factor-a (TNF-a) (DY410), and IL-6 (DY406) kits were obtained from R&D Systems (Minneapolis, MN, USA).
Flow cytometry to detect T lymphocyte subsets in mouse spleen cells
Spleen tissue was collected, washed, ground, and filtered. Three milliliters of Roswell Park Memorial Institute-1640 medium (12633020, Thermo Fisher Scientific, Waltham, MA, USA) were used to resuspend the precipitated cells. Phorbol 12-myristate 13-acetate/ionomycin (CS1001, Multisciences [Lianke] Biotech, Co., Ltd., Hangzhou, China) and brefeldin A/monensin (CS1002, Multisciences [Lianke] Biotech, Co., Ltd., Hangzhou, China) were added, and the cells were incubated at 37°C with 5% carbon dioxide. After being incubated for 14 h, the cells were collected into flow tubes. Following a phosphate buffer saline (PBS) wash, the cells were resuspended and centrifuged, and the supernatant was discarded. A fixed permeabilization solution (500 μL, P0096, Beyotime Biotechnology, Shanghai, China) was then added. Following uniform blowing, the cells were centrifuged, and the supernatant was discarded after being incubated for 30 min at room temperature in the dark. After 500 μL of the permeabilization solution was added and uniformly blown out, it was allowed to sit at room temperature in the dark for 0.5 h. After the supernatant was centrifuged and discarded, the cells were resuspended in PBS, and 1 μL each of CD4+ IFN-g+, CD4+ IL-17+, and corresponding isotype controls was added. The cells were gently mixed, incubated at room temperature in the dark, washed with PBS, and detected by flow cytometry (BD FACSCalibur, BD Biosciences, San Jose, CA, USA) to determine the differentiation of T lymphocyte subsets. The following antibodies were used for cell identification: Anti-CD4-fluorescein isothiocyanate (FITC) (Clone RM4-5, 553046, BD Biosciences, Franklinhoo, New Jersey, USA), anti-CD25-PE (Clone PC61, 553866, BD Biosciences, Franklinhoo, New Jersey, USA), and anti-Foxp3-allophycocyanin (APC) (Clone 236A/E7, 17-4777-42, eBioscience, Waltham, MA, USA) for Treg cells; anti-CD4-FITC and anti-IL-17-phycoerythrin (PE) (Clone TC11-18H10, 562542, BD Biosciences, Franklinhoo, New Jersey, USA) for Th17 cells; and anti-CD4-FITC and anti-IFN-g-PE (Clone XMG1.2, 562303, BD Biosciences, Franklinhoo, New Jersey, USA) for Th1 and Th2 cells. Isotype controls were used to confirm antibody specificity. The results were analyzed by FlowJo (version 1.8, BD Biosciences, Franklin, New Jersey, USA).
Cell counting kit-8 (CCK-8) assay
100 μL of the cell suspension (2000 cells) was added to a 96-well plate, and then, 10 μL of CCK-8 solution (C0038, Beyotime Biotechnology, Shanghai, China) was added and incubated for 1 h. Finally, the absorbance was determined at 450 nm using an microplate reader.
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) for detection of messenger RNA expression
The collected tissues were carefully ground in a grinder containing 1 mL of TRIzol (R0016, Beyotime Biotechnology, Shanghai, China). After the tissues were incubated for 5 min, the total RNA was extracted using the conventional method. The extracted RNA was reverse transcribed into complementary deoxyribonucleic acid (cDNA) in accordance with the kit’s instructions (RR037Q, TaKaRa Bio Inc., Kofu City, Yamanashi Prefecture, Japan). Then, 1 μL of retro-transcriptional product was added as the reaction template. The reaction system was 20 μL. Detected was conducted using real-time fluorescence quantitative polymerase chain reaction. The following reaction conditions were used: denaturation at 95°C for 10 min, followed by cycles of 40 at 95°C for 15 s and 60°C for 60 s. Following the reaction, the computed tomography value was determined. The relative expression of the gene was calculated using the 2−△△Ct method. The primer sequences are shown in Table 1.
| Primers | Forward (5‘–3’) | Reverse (5‘–3’) |
|---|---|---|
| MC1R | GACCTGCTGGTGAGCTTGCC | CAGGAACCAGAGGAGGAAGG |
| IL-1β | TTGACGGACCCCAAAAGATG | AGAAGGTGCTCATGTCCTCA |
| IL-6 | GTTCTCTGGGAAATCGTGGA | TGTACTCCAGGTAGCTATGG |
| TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
| GAPDH | AGGTCGGTGTGAACGGATTTG | GGGGTCGTTGATGGCAACA |
MC1R: Melanocortin 1 receptor, IL: Interleukin, TNF-α: Tumor necrosis factor-α, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
Western blot
The synovial tissue was washed with pre-cooled PBS buffer. Then, 50 μL of lysis buffer (R0010, Solarbio, Beijing, China) was added and mixed with 100 mm phenylmethanesulfonyl fluoride at a ratio of 100:1. The tissue was incubated for 25 min until complete lysis using TissueLyser II (Qiagen, Hilden, Germany). The protein was aspirated into an Eppendorf tube and centrifuged at 12,000 rpm for 5 min at 4°C. The supernatant was collected and stored in a −80 °C environment. The protein content was measured using a bicinchoninic acid (BCA) kit (PC0020, Solarbio, Beijing, China), and the amount of protein was calculated. Sodium dodecyl–sulfate polyacrylamide gel electrophoresis was prepared, and the sample was added. The sample was separated under 100 V electrophoresis conditions, and the proteins were transferred to a pre-prepared polyvinylidene fluoride membrane (IPVH00010, Millipore Corporation, Billerica, MA, USA) for 1 h. The membrane was blocked with 5% skim milk powder for 2 h, and diluted antibodies (1:1000) were added. Phosphorylated signal transducer and activator of transcription 3 (Phospho-STAT3) (9145), STAT3 (4904), T-bet (13232). Retinoic acid receptor-related orphan receptor g-t (RORgt) (ab207082), IL-17 (ab79065), IFN-g (ab9657), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ab8245) were obtained from Abcam (Cambridge, MA, USA). The membrane was incubated overnight on a shaker at 4°C. The membrane was washed with tris-buffered saline with tween-20 (TBST), (BL2351A, Biosharp, Hubei, China) for 5–10 min, 3 times. The secondary antibody (Horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G [1:5000, Cell Signaling Technology, 7074, CST, Boston, MA, USA]) was incubated for 1 h, and the membrane was washed with TBST. The protein was detected using an enhanced chemiluminescence (ECL) kit (BL520b, Biosharp, Hefei, Anhui, China). Images were captured using the ChemiDoc XRS+ imaging system (Bio-Rad, CA, USA). The gray value of the protein was analyzed by ImageJ (version 1.8, National Institutes of Health, Bethesda, MD, USA).
Statistical analysis
The Statistical package for the social sciences (version 20.0, IBM Corp., Armonk, NY, USA) was used for data analysis. The experimental data were expressed as mean ± standard deviation. Independent sample t-test was used for comparison between two independent samples. One-way analysis of variance and Tukey multiple-range tests were used for comparison among multiple groups. P < 0.05 indicated a statistically significant difference.
RESULTS
Deletion of MC1R does not affect the immune system in mice under resting conditions
White blood cells, lymphocytes, monocytes, and neutrophils are important cell types in the immune system. In this experiment, the absolute numbers of these cells in the blood of WT mice and MC1R-KO mice under resting conditions were measured. The results showed no significant difference in the numbers of white blood cells, lymphocytes, monocytes, and neutrophils between the two groups [Figure 1a-d]. Figure 1e-h shows no significant difference in the proportions of white blood cells, lymphocytes, monocytes, and neutrophils between the WT and MC1R-KO mice under resting conditions.

- Effects of MC1R deletion on the immune system of mice at rest. (a-d) Absolute values of blood leukocytes, lymphocytes, monocytes, and neutrophils in resting WT and MC1R-KO mice. (e-h) Proportions of blood leukocytes, lymphocytes, monocytes, and neutrophils in resting WT and MC1R-KO mice. n = 3. Data are the mean ± Standard deviation. ns: Not significant. MC1R: Melanocortin 1 receptor, MC1R KO: Melanocortin 1 receptor knockout, WT: Wild type.
MC1R-KO mice are more susceptible to DNFB-induced DTH
Figure 2a shows that the deletion of MC1R increased the proliferation capacity of spleen cells (P < 0.01). The proliferation capacity of spleen cells from the MC1R-KO mice was higher. The increased cell proliferation capacity may be due to the deletion of MC1R leading to excessive activation of the immune system, thereby enhancing immune response. DTH was elicited by DNFB in paired WT and MC1R-KO mice from the same litter. Ear swelling levels were measured. The ear swelling levels in the MC1R-KO mice were higher [Figure 2b], (P < 0.01). DNFB-induced DTH is a T cell-mediated allergic reaction, and the increased ear swelling levels indicated increased sensitivity to this allergic reaction in MC1R-KO mice. Spleen weight measurements showed that the spleen weight of the MC1R-KO mice was higher (P < 0.01). The spleen is an important organ of the immune system, and an increase in spleen weight can reflect the degree of immune system activation [Figure 2c], (P < 0.01). As a result, MC1R deletion may cause the immune system to become overactive, which could increase the weight of the spleen. The spleen index of the MC1R-KO mice was higher [Figure 2d], (P < 0.01). This finding provides more evidence that the loss of MC1R causes an overabundance of immune system activation. TNF-a and IL-6 were compared among different groups of mice. The TNF-a and IL-6 levels in MC1R-KO mice were higher [Figure 2e and f], (P < 0.01). This finding indicates that the deletion of MC1R enhances the inflammatory response in the immune system. The deletion of MC1R increased the susceptibility of mice to DNFB-induced DTH and may be due to the deletion of MC1R leading to excessive activation of the immune system and enhanced inflammatory response.

- MC1R-KO mice showing no resistance to DNFB-induced DTH. (a) Increase in the proliferation ability of splenocytes by MC1R deletion. (b) Ear swelling levels of WT and MC1R-KO mice from the same litter subjected to DNFB-induced DTH. (c) Spleen weight. (d) Spleen index of mice in different groups. (e and f) Detection of TNF-a and IL-6 levels in different groups of mice. n = 3. Data are the mean ± Standard deviation. ✶✶P < 0.01, ns: Not significant. MC1R KO: Melanocortin 1 receptor knockout, DNFB: Dinitrofluorobenzene, DTH: Delayed-type hypersensitivity, MC1R: Melanocortin 1 receptor, WT: Wild type, TNF-a: Tumor necrosis factor-a, IL: Interleukin.
MC1R-KO mice are more susceptible to CIA stimulation
The degree of inflammation in the paws is an indicator for evaluating the severity of arthritis. The degree of paw inflammation in MC1R-KO mice was higher. This finding indicates that the deletion of MC1R increased the susceptibility of mice to CIA-induced arthritis [Figure 3a]. Clinical scores are indicators for evaluating the severity of arthritis, including joint swelling, erythema, and stiffness.

- MC1R-KO mice being more sensitive to CIA stimulation. (a) Representative images of the feet of WT and MC1R-KO mice treated with CII. (b) Clinical scores of mice treated with CII. (c) Incidence of arthritis in mice treated with CII. (d) Representative histopathological sections of joints in WT and MC1R-KO CIA mice. Untreated mice were used as negative controls. Scale bar: 100 or 200 μm. Objective: ×400 or ×200. The red arrows point to the areas with obvious damage. (e) Statistical data on histopathological scores of mouse tissues. (f) Serum anti-CII antibody levels. n = 3. Data are the mean ± Standard deviation. ✶✶P < 0.01. Ctrl: Control, MC1R KO: Melanocortin 1 receptor knockout, CIA: Collagen-induced arthritis, WT: Wild type, MC1R: Melanocortin 1 receptor.
The clinical scores of the MC1R-KO mice were higher, supporting the increased susceptibility of this group to CIA-induced arthritis [Figure 3b], (P < 0.01). Arthritis incidence is an indicator for evaluating the occurrence of arthritis. The arthritis incidence in the MC1R-KO mice was higher [Figure 3c], (P < 0.01), indicating that the deletion of MC1R increased the occurrence of CIA-induced arthritis. The degree of arthritis inflammation and tissue damage in MC1R-KO mice was higher. The red arrows in Figure 3d showed degenerative necrosis of articular cartilage, infiltration of synovitis cells, and proliferation and necrosis of synovitis cells in MC1R-KO mice. This finding supports the increased susceptibility of MC1R-KO mice to CIA-induced arthritis. The histopathological scores of the MC1R-KO mice were higher [Figure 3e], (P < 0.01). The anti-type II collagen (CII) antibodies in the serum are indicators for evaluating the autoimmune response. The anti-CII antibodies in the serum of MC1R-KO mice were higher [Figure 3f], (P < 0.01), indicating that the deletion of MC1R increased the autoimmune response to CII induction. The MC1R-KO mice were more susceptible to CIA-induced arthritis, showing more severe inflammation, higher arthritis incidence, more severe histopathological damage, and higher levels of anti-CII antibodies.
MC1R deletion affects the distribution of T cell subsets in CIA mice
As shown in Figure 4a-d, the percentage of Th1 cells in the spleen tissue of MC1R-KO mice was higher in CIA (P < 0.01). This finding indicates that the deletion of MC1R increased the proportion of Th1 cells in CIA mice, which may lead to a strengthened cellular immune response. In CIA mice, the percentage of Th2 cells in the spleen tissue of MC1R-KO mice was lower (P < 0.05). This finding suggests that MC1R deletion reduced the percentage of Th2 cells in CIA mice, perhaps leading to an immunological response imbalance. As shown in Figure 4e-h, the percentage of Treg cells in the spleen tissue of MC1R-KO mice was lower in CIA mice (P < 0.01). This finding indicates that the deletion of MC1R decreased the proportion of Treg cells in CIA mice, which may result in a loss of immune regulation. In CIA mice, the percentage of Th17 cells in the spleen tissue of MC1R-KO mice was higher (P < 0.01). This finding indicates that the deletion of MC1R increased the proportion of Th17 cells in CIA mice, which may result in a strengthened inflammatory response. The deletion of MC1R affected the distribution of T cell subsets in CIA mice. In particular, Th1 and Th17 cell proportions are larger in MC1R-KO animals, but Th2 and Treg cell proportions are lower in CIA, possibly leading to an imbalance in immune response and a strengthened inflammatory response.

- Effects of MC1R deletion on T cell subsets in CIA mice. (a-d) Fluorescence-activated cell sorting (FACS) kanalysis of splenic tissue cells from WT and MC1R-KO mice under CIA. Percentages of Th1 (a and c) and Th2 (b and d) cells were measured. (e-h) FACS analysis of splenic tissue cells from WT and MC1R-KO mice under CIA. Percentages of Treg (e and g) and Th17 (f and h) cells were measured. n=3. Data are the mean ± Standard deviation. ✶P < 0.05, ✶✶P < 0.01, ns: Not significant. MC1R: Melanocortin 1 receptor, CIA: Collagen-induced arthritis, MC1R KO: Melanocortin 1 receptor knockout, Th: T helper, WT: Wild type, IFN-g: Interferon-g; Treg: Regulatory T, Foxp3: Forkhead box protein P3.
MC1R-KO mice promote the production of inflammatory cytokines in CII-treated mice
Under CII treatment, the IL-17 and IFN-g in MC1R-KO mice were higher [Figure 5a and b], (P < 0.01). This finding suggests that MC1R deletion enhanced the inflammatory response by increasing IL-17 and IFN-g production in CII-treated animals. Under CII treatment, the IL-10 and IL-4 levels in MC1R-KO mice were lower [Figure 5c and d], (P < 0.01). This finding indicates that the deletion of MC1R decreased the production of IL-10 and IL-4 in CII-treated mice, resulting in a weakened anti-inflammatory response.

- MC1R-KO promotes the production of inflammatory cytokines in CII-treated mice. (a and b) ELISA measurement of pro-inflammatory cytokines, including IL-17 and IFN-g. (c and d) ELISA measurement of anti-inflammatory cytokines, including IL-10 and IL-4. (e-g) qRT-PCR measurement of cytokines, including IL-6, TNF-a, and IL-1b. (h-m) Western blot analysis to validate changes in immune-related markers by detecting the protein expression levels of p-STAT3, STAT3, T-bet, RORgt, IL-17, and IFN-g. n = 3. Data are the mean ± Standard deviation. ✶✶P < 0.01, ✶✶✶P < 0.001, ns: Not significant. MC1R KO: Melanocortin 1 receptor knockout, ELISA: Enzyme-linked immunosorbent assay, IL: Interleukin, IFN-g: Interferon, TNF-a: Tumor necrosis factor-a, p-STAT3: Phospho-signal transducer and activator of transcription 3, RORgt: Retinoic acid receptor-related orphan receptor g-t, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, qRT-PCR: Quantitative reverse transcription polymerase chain reaction.
IL-6, TNF-a, and IL-1b are three cytokines closely associated with inflammation. The IL-6, TNF-a, and IL-1β levels in MC1R-KO mice were higher (P < 0.01), as measured by qRTPCR [Figure 5e-g]. This finding supports the conclusion that the deletion of MC1R promotes the inflammatory response. Finally, the changes in immune-related markers of protein expression in the joint tissues of mice were validated. The p-STAT3, T-bet, RORgt, IL-17, and IFN-g levels in MC1RKO mice were higher [Figure 5h-m], (P < 0.01). MC1R-KO promoted the production of IL-17 and IFN-g in mice and inhibited the expression of IL-10 and IL-4. This finding further enhanced the inflammatory response and cellular immune response and validated the changes in immune-related protein expression.
MC1R-KO mice exhibit higher CII-specific T cell immune response in splenocytes in vitro
As shown in Figure 6a-d, the changes in Th17 cell proportions showed that the splenocytes of MC1R-KO mice exhibited higher proportions of Th17 cells after in vitro culture than the splenocytes of WT mice (P < 0.01). This finding indicates that the deletion of MC1R increased the immune response of CII-specific Th17 cells, further enhancing the autoimmune response. Treg cells are a subtype of T cells that produce IL-10 and mainly participate in immune regulation. The splenocytes of MC1R-KO mice exhibited lower proportions of Treg cells after in vitro culture (P < 0.05). This finding indicates that the deletion of MC1R decreased the immune response of CII-specific Treg cells, resulting in a weakened immune regulation. After in vitro culture, the splenocytes of MC1R-KO mice exhibited higher levels of IL-17 and IFN-g than the splenocytes of WT mice [Figure 6e and f], (P < 0.01). This result indicates that the deletion of MC1R increased the production of CII-specific Th17 and Th1 cells, further enhancing the inflammatory response. After in vitro culture, the splenocytes of MC1R-KO mice exhibited lower levels of IL-10 and IL-4 [Figure 6g and h], (P < 0.01). This result indicates that the deletion of MC1R decreased the production of CII-specific Treg and Th2 cells, resulting in a weakened anti-inflammatory response. The deletion of MC1R enhanced the immune response of CII-specific Th17 and Th1 cells, strengthened the inflammatory response, and decreased the immune response of CII-specific Treg and Th2 cells, resulting in a weakened anti-inflammatory response.

- MC1R-KO mouse splenocytes displaying higher CII-specific T cell immune response in vitro. (a-d) Proportions of Th17 cells and Treg cells within the cell population measured by FACS analysis. (e and f) Changes in the levels of pro-inflammatory cytokines IL-17 and IFN-g measured by ELISA. (g and h) Changes in the levels of anti-inflammatory cytokines IL-10 and IL-4 measured by ELISA. n=3. Data are the mean ± Standard deviation. ✶P < 0.05, ✶✶P < 0.01, ns: Not significant. MC1R KO: Melanocortin 1 receptor knockout, Th17: T helper 17, ELISA: Enzyme-linked immunosorbent assay, IL: Interleukin, IFN-g: Interferon.
Stattic inhibits inflammation in MC1R-KO mice
Figure 7a-g shows that the expression levels of pro-inflammatory factors in MC1R-KO mice treated with Stattic decreased significantly, whereas those of anti-inflammatory factors increased significantly (P < 0.01). The expression levels of p-STAT3, T-bet, RORgt, IL-17, and IFN-g in MC1RKO + stattic mice are shown in Figure 7h-m. The results showed that the expression levels of these proteins decreased significantly (P < 0.05), indicating that STAT3/T-bet/RORgt plays a key role in the treatment of MC1R and arthritis.

- Stattic inhibits the expression levels of proinflammatory factors in MC1R-KO mice. (a-e) Changes in the levels of pro-inflammatory cytokines IL-17, IFN-g, IL-6, IL-1b, and TNF-a measured by ELISA. (f and g) Changes in the levels of anti-inflammatory cytokines IL-10 and IL-4 measured by ELISA. (h-m) Western blot analysis to validate changes in immune-related markers by detecting the protein expression levels of p-STAT3, STAT3, T-bet, RORgt, IL-17, and IFN-g. n = 3. Data are the mean ± Standard deviation. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. MC1R KO: Melanocortin 1 receptor knockout, IL: Interleukin, IFN-g: Interferon, TNF-a: Tumor necrosis factor-a, ELISA: Enzyme-linked immunosorbent assay, p-STAT3: Phospho-signal transducer and activator of transcription 3, RORgt: Retinoic acid receptor-related orphan receptor g-t.
DISCUSSION
The findings demonstrated that the knockout of MC1R resulted in an exacerbation of joint inflammation and damage, indicating a regulatory role for MC1R in CIA. The MC1R mutant animals had an imbalance in T cell subsets, with an increase in Th1 and Th17 cells and a decrease in Treg cells. These results imply that in the context of CIA, MC1R is essential for regulating T cell responses and immunological control.
In the absence of MC1R, Th1 and Th17 cells are upregulated, which is in line with earlier research that linked these T cell subsets to the etiology of RA.[34] Th1 cells are known to support cell-mediated immune responses and contribute to the chronic inflammation seen in RA joints because they produce IFN-g.[8,35,36] Meanwhile, the production of IL-17 by Th17 cells contributes to tissue inflammation and neutrophil recruitment.[37,38] The MC1R mutant mice’s higher Th1 and Th17 cell counts could be a factor in the worsened inflammatory response and joint injury among patients with CIA.
The idea that MC1R is involved in immune control is further supported by the reduction in Treg cells in the absence of MC1R. Treg cells are essential for preventing overreactions from the immune system and preserving immunological tolerance.[39] The dysregulated immune response and persistence of chronic inflammation in RA are caused by an imbalance between pro-inflammatory and anti-inflammatory T cell subsets, as well as a reduction in Treg cells.[37,40] The reduction in Treg cells observed in the MC1R knockout mice may contribute to the enhanced inflammatory response and joint damage in CIA.
The molecular process by which MC1R controls T cell subsets in the CIA remains unclear. The possible mechanism of MC1R regulating the proportion of T cells can be discussed using the Western blot results. First, the upregulation of p-STAT3 in MC1R-KO mice was observed. STAT3 is an important signaling molecule involved in regulating the differentiation and function of Th17 cells.[41,42] According to earlier research, the MC1R signaling pathway may activate STAT3 to encourage the growth of Th17 cells. Therefore, the loss of MC1R may lead to the upregulation of p-STAT3, thereby increasing the differentiation of Th17 cells and the production of IL-17. Second, changes in T-bet and RORgt were observed in MC1R-KO mice. According to earlier research, the MC1R signaling pathway may influence Th1 and Th17 cell development by controlling T-bet and RORgt expression. Therefore, the loss of MC1R may lead to changes in T-bet and RORgt, thereby affecting the differentiation and function of Th1 and Th17 cells. Additional investigation revealed that MC1R-KO mice had significantly higher levels of IFN-g and IL-17. Th1 cells are the only cells that produce IFN-g, whereas Th17 cells are the only cells that create IL-17. Therefore, MC1R may affect the production of IL-17 and IFN-g by regulating the differentiation and function of Th17 and Th1 cells.[43,44] On the basis of Western blot data, MC1R may control Th1 and Th17 cell development and function by controlling the expression levels and activation of important transcription factors, such T-bet, RORgt, and STAT3, which, in turn, affect the synthesis of IFN-g and IL-17.[45] However, further research is needed to validate these hypotheses and explore the interaction and regulatory mechanisms between MC1R and other signaling pathways.
The dysregulation of T cell subsets in the absence of MC1R raises the question of whether targeting MC1R could be a potential therapeutic strategy for RA. Modulating T cell responses and restoring immune balance could potentially alleviate inflammation and joint damage in RA. However, a notable detail that MC1R is expressed in various cell types and tissues, and its functions extend beyond immune regulation. Therefore, any therapeutic approach targeting MC1R needs to consider potential off-target effects and carefully evaluate the overall effect on the immune system. In addition to its role in T cell regulation, MC1R may have direct effects on other immune cells and inflammatory mediators. For instance, MC1R influences the synthesis of pro-inflammatory cytokines in synovial fibroblasts and macrophages, including TNF-a and IL-6. These cytokines contribute to tissue damage and joint inflammation, and they are essential to the pathophysiology of RA. More research is required to clarify the precise processes by which MC1R regulates inflammatory mediators and immunological responses in the setting of RA.
SUMMARY
The knockout of MC1R resulted in an exacerbation of joint inflammation and damage, accompanied by an imbalance in T cell subsets, characterized by an increase in Th1 and Th17 cells and a decrease in Treg cells. These results indicate the importance of T cell homeostasis and immune control in RA and increase the possibility that MC1R could be a viable therapeutic target for modifying T cell responses and reestablishing immunological balance in RA. More investigation is required to understand the molecular processes by which MC1R regulates T cell subsets and investigate the potential therapeutic benefits of targeting MC1R in RA and other autoimmune disorders.
AVAILABILITY OF DATA AND MATERIALS
The datasets used and analyzed during the current study were available from the corresponding author on reasonable request.
ABBREVIATIONS
MC1R: Melanocortin 1 receptor
CIA: Collagen-induced arthritis
Th: T helper
Treg: Regulatory T
IL: Interleukin
IFN: Interferon
MC1R-KO: MC1R knockout
RA: Rheumatoid arthritis
Foxp3: Forkhead box protein P3
GPCR: G protein-coupled receptor
WT: Wild-type
DNFB: 2,4-Dinitrofluorobenzene
ELISA: Enzyme-linked immunosorbent assay
TNF-α: Tumor necrosis factor-α
PBS: Phosphate buffer saline
FITC: Fluorescein isothiocyanate
APC: Allophycocyanin
PE: Phycoerythrin
CCK-8: Cell counting kit-8
qRT-PCR: Quantitative reverse transcription polymerase chain reaction
cDNA: Complementary deoxyribonucleic acid
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
BCA: Bicinchoninic acid
phospho-STAT3: Phosphorylated signal transducer and activator of transcription 3
TBST: Tris-buffered saline with tween-20
ECL: Enhanced chemiluminescence
AUTHOR CONTRIBUTIONS
BS and LBB: Designed the study; All authors conducted the study; LJC and PS: Collected and analyzed the data; FDM and HFY: Participated in drafting the manuscript, and all authors contributed to critical revision of the manuscript for important intellectual content. All authors participated fully in the work, took public responsibility for appropriate portions of the content, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or completeness of any part of the work were appropriately investigated and resolved. All authors read and approved of the final manuscript. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Shandong Provincial Hospital Affiliated to Shandong First Medical University. The study was approved by the Institutional Animal Care and Use Committee of Shandong Provincial Hospital Affiliated to Shandong First Medical University (NO.SD NSFC [YS] 2023-26). Informed consent to participate is not required, as this study does not involve human subjects.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Shandong Provincial Hospital: Study on the molecular mechanism of nano-copper oxide in alleviating CFA-induced rheumatoid arthritis in rats.
References
- EULAR definition of difficult-to-treat rheumatoid arthritis. Ann Rheum Dis. 2021;80:31-5.
- [CrossRef] [PubMed] [Google Scholar]
- The immunology of rheumatoid arthritis. Nat Immunol. 2021;22:10-8.
- [CrossRef] [PubMed] [Google Scholar]
- Traditional herbal medicine: Therapeutic potential in rheumatoid arthritis. J Ethnopharmacol. 2021;279:114368.
- [CrossRef] [PubMed] [Google Scholar]
- Rheumatoid arthritis: Pathogenic roles of diverse immune cells. Int J Mol Sci. 2022;23:905.
- [CrossRef] [PubMed] [Google Scholar]
- Function and role of regulatory T cells in rheumatoid arthritis. Front Immunol. 2021;12:626193.
- [CrossRef] [PubMed] [Google Scholar]
- Cytotoxic CD8(+) T cells target citrullinated antigens in rheumatoid arthritis. Nat Commun. 2023;14:319.
- [CrossRef] [PubMed] [Google Scholar]
- Dendritic cells, T cells and their interaction in rheumatoid arthritis. Clin Exp Immunol. 2019;196:12-27.
- [CrossRef] [PubMed] [Google Scholar]
- T helper cells in synovial fluid of patients with rheumatoid arthritis primarily have a Th1 and a CXCR3+Th2 phenotype. Arthritis Res Ther. 2020;22:245.
- [CrossRef] [PubMed] [Google Scholar]
- Th17 cell pathogenicity and plasticity in rheumatoid arthritis. J Leukoc Biol. 2019;106:1233-40.
- [CrossRef] [PubMed] [Google Scholar]
- Aberrant expression of USF2 in refractory rheumatoid arthritis and its regulation of proinflammatory cytokines in Th17 cells. Proc Natl Acad Sci U S A. 2020;117:30639-48.
- [CrossRef] [PubMed] [Google Scholar]
- EZH2 deficiency attenuates treg differentiation in rheumatoid arthritis. J Autoimmun. 2020;108:102404.
- [CrossRef] [PubMed] [Google Scholar]
- Protectin DX restores Treg/Th17 cell balance in rheumatoid arthritis by inhibiting NLRP3 inflammasome via miR-20a. Cell Death Dis. 2021;12:280.
- [CrossRef] [PubMed] [Google Scholar]
- Imbalance of Th17, treg, and helper innate lymphoid cell in the peripheral blood of patients with rheumatoid arthritis. Clin Rheumatol. 2022;41:3837-49.
- [CrossRef] [PubMed] [Google Scholar]
- MC1R and the response of melanocytes to ultraviolet radiation. Mutat Res. 2005;571:133-52.
- [CrossRef] [PubMed] [Google Scholar]
- Genetic association and cellular function of MC1R variant alleles in human pigmentation. Ann N Y Acad Sci. 2003;994:348-58.
- [CrossRef] [PubMed] [Google Scholar]
- MC1R variants, melanoma and red hair color phenotype: A meta-analysis. Int J Cancer. 2008;122:2753-60.
- [CrossRef] [PubMed] [Google Scholar]
- Evidence for variable selective pressures at MC1R. Am J Hum Genet. 2000;66:1351-61.
- [CrossRef] [PubMed] [Google Scholar]
- Skin colour and skin cancer-MC1R, the genetic link. Melanoma Res. 2002;12:405-16.
- [CrossRef] [PubMed] [Google Scholar]
- Behind the scene: Exploiting MC1R in skin cancer risk and prevention. Genes (Basel). 2021;12:1093.
- [CrossRef] [PubMed] [Google Scholar]
- Peripheral MC1R activation modulates immune responses and is neuroprotective in a mouse model of Parkinson's disease. J Neuroimmune Pharmacol. 2023;18:704-17.
- [CrossRef] [PubMed] [Google Scholar]
- MC1R functions, expression, and implications for targeted therapy. J Invest Dermatol. 2022;142:293-302.e1.
- [CrossRef] [PubMed] [Google Scholar]
- MC1R-dependent, melanin-based colour polymorphism is associated with cell-mediated response in the Eleonora's falcon. J Evol Biol. 2011;24:2055-63.
- [CrossRef] [PubMed] [Google Scholar]
- Loss-of-function mutations in melanocortin-1 receptor modulate immune response in teleost fishes. Fish Shellfish Immunol. 2022;131:838-46.
- [CrossRef] [PubMed] [Google Scholar]
- Activation of melanocortin-1 receptor signaling in melanoma cells impairs T cell infiltration to dampen antitumor immunity. Nat Commun. 2023;14:5740.
- [CrossRef] [PubMed] [Google Scholar]
- Translational research in rheumatoid arthritis: Exploiting melanocortin receptors London, UK: Queen Mary University of London; 2014.
- [Google Scholar]
- Melanocortin 2, 3 and 4 receptor gene expressions are downregulated in CD8+ T cytotoxic lymphocytes and CD 19+ B lymphocytes in rheumatoid arthritis responding to TNF-a inhibition. Scand J Immunol. 2017;86:31-9.
- [CrossRef] [PubMed] [Google Scholar]
- Brown adipose tissue-derived exosomes improve polycystic ovary syndrome in mice via STAT3/GPX4 signaling pathway. FASEB J. 2024;38:e70062.
- [CrossRef] [PubMed] [Google Scholar]
- Immunisation against heterologous type II collagen induces arthritis in mice. Nature. 1980;283:666-8.
- [CrossRef] [PubMed] [Google Scholar]
- IL-25 Attenuates rheumatoid arthritis via inhibition of the TLR4/NF-κB/NLRP3 signaling pathway. Discov Med. 2025;37:2687-701.
- [CrossRef] [Google Scholar]
- New Properties of a well-known antioxidant: Pleiotropic effects of human Lactoferrin in mice exposed to gamma irradiation in a sublethal dose. Antioxidants (Basel). 2022;11:1833.
- [CrossRef] [PubMed] [Google Scholar]
- TNF antagonist sensitizes synovial fibroblasts to ferroptotic cell death in collagen-induced arthritis mouse models. Nat Commun. 2022;13:676.
- [CrossRef] [PubMed] [Google Scholar]
- Quercetin-mediated SIRT1 activation attenuates collagen-induced mice arthritis. J Ethnopharmacol. 2021;279:114213.
- [CrossRef] [PubMed] [Google Scholar]
- Tumor microenvironment in gastric cancers. Cancer Sci. 2020;111:2696-707.
- [CrossRef] [PubMed] [Google Scholar]
- The balance of Th1/Th2 cytokines in rheumatoid arthritis. Best Pract Res Clin Rheumatol. 2001;15:677-91.
- [CrossRef] [PubMed] [Google Scholar]
- The pathogenic importance of CCL21 and CCR7 in rheumatoid arthritis. Cytokine Growth Factor Rev. 2020;55:86-93.
- [CrossRef] [PubMed] [Google Scholar]
- Secretory factors produced by adipose mesenchymal stem cells downregulate Th17 and increase treg cells in peripheral blood mononuclear cells from rheumatoid arthritis patients. Rheumatol Int. 2019;39:819-26.
- [CrossRef] [PubMed] [Google Scholar]
- Mesenchymal stem cell repression of Th17 cells is triggered by mitochondrial transfer. Stem Cell Res Ther. 2019;10:232.
- [CrossRef] [PubMed] [Google Scholar]
- Sirolimus selectively increases circulating treg cell numbers and restores the Th17/treg balance in rheumatoid arthritis patients with low disease activity or in DAS28 remission who previously received conventional disease-modifying anti-rheumatic drugs. Clin Exp Rheumatol. 2020;38:58-66.
- [CrossRef] [Google Scholar]
- Arsenic trioxide improves treg and Th17 balance by modulating STAT3 in treatment-naïve rheumatoid arthritis patients. Int Immunopharmacol. 2019;73:539-51.
- [CrossRef] [PubMed] [Google Scholar]
- A STAT3 palmitoylation cycle promotes T(H)17 differentiation and colitis. Nature. 2020;586:434-9.
- [CrossRef] [PubMed] [Google Scholar]
- PKM2 promotes Th17 cell differentiation and autoimmune inflammation by fine-tuning STAT3 activation. J Exp Med. 2020;217:e20190613.
- [CrossRef] [PubMed] [Google Scholar]
- Role of IFN-gamma in Th1 differentiation: IFN-gamma regulates IL-18R alpha expression by preventing the negative effects of IL-4 and by inducing/maintaining IL-12 receptor beta 2 expression. J Immunol. 2002;168:6165-72.
- [CrossRef] [PubMed] [Google Scholar]
- Induced recruitment of NK cells to lymph nodes provides IFN-gamma for T(H)1 priming. Nat Immunol. 2004;5:1260-5.
- [CrossRef] [PubMed] [Google Scholar]
- Distinct effects of T-bet in TH1 lineage commitment and IFN-gamma production in CD4 and CD8 T cells. Science. 2002;295:338-42.
- [CrossRef] [PubMed] [Google Scholar]

