Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Filter by Categories
Abstracts
Book Review
Case Report
Case Series
CMAS‡ - Pancreas - EUS-FNA Cytopathology (PSC guidelines) S1:1 of 5
CMAS‡ - Pancreas - EUS-FNA Cytopathology (PSC guidelines) S1:3 of 5
CMAS‡ - Pancreas - EUS-FNA Cytopathology (PSC guidelines) S1:4 of 5
CMAS‡ - Pancreas -Sampling Techniques for Cytopathology (PSC guidelines) S1:2 of 5
CMAS‡ - Pancreas- EUS-FNA Cytopathology (PSC guidelines) S1:5 of 5
Commentary
Correction
CytoJournal Monograph Related Review Series
CytoJournal Monograph Related Review Series (CMAS), Editorial
CytoJournal Monograph Related Review Series: Editorial
Cytojournal Quiz Case
Editorial
Erratum
Letter to Editor
Letter to the Editor
Letters to Editor
Methodology
Methodology Article
Methodology Articles
Original Article
Pap Smear Collection and Preparation: Key Points
Quiz Case
Research
Research Article
Review
Review Article
Systematic Review and Meta Analysis
View Point
View/Download PDF

Translate this page into:

Research Article
2025
:22;
63
doi:
10.25259/Cytojournal_271_2024

Membrane-spanning 4 domains subfamily A member 4A inhibition promotes M1 macrophage polarization and enhances anti-gastric cancer immune response

Department of Surgical Oncology and General Surgery, The First Hospital of China Medical University; Key Laboratory of Precision Diagnosis and Treatment of Gastrointestinal Tumors (China Medical University), Ministry of Education, Shenyang, China.
Author image
Corresponding author: Di Na, Department of Surgical Oncology and General Surgery, The First Hospital of China Medical University; Key Laboratory of Precision Diagnosis and Treatment of Gastrointestinal Tumors (China Medical University), Ministry of Education, Shenyang, China. zzz2023120828@163.com
Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

How to cite this article: Zhang X, Na D. Membrane-spanning 4 domains subfamily A member 4A inhibition promotes M1 macrophage polarization and enhances anti-gastric cancer immune response. CytoJournal. 2025;22:63. doi: 10.25259/Cytojournal_271_2024

Abstract

Objective:

The immunosuppressive tumor microenvironment (TME) limits the treatment effectiveness of immunotherapy in gastric cancer (GC). This study investigated the role of membrane-spanning four domains subfamily A member 4A (MS4A4A) in the regulation of macrophage polarization and its effect on the immune response in GC, with the aim of enhancing the effectiveness of immunotherapy by addressing the immunosuppressive TME.

Material and Methods:

A GC ectopic tumor model was initiated in C57BL/6 mice with subcutaneous MKN-45 injection. Five groups were formed by randomly dividing the mice: model, MS4A4A recombinant protein, MS4A4A antibody, programmed cell death protein 1 (PD-1) antibody, and MS4A4A recombinant protein + PD-1 antibody groups. MKN-45 cells and bone marrow-derived macrophages (BMDMs) were cocultured with the MS4A4A protein or antibody. Macrophage polarization was analyzed through flow cytometry, gene expression through quantitative real-time polymerase chain reaction (qRT-PCR), cytokine levels through enzyme-linked immunosorbent assay, protein expression through Western blot, and tumor morphology through hematoxylin and eosin staining.

Results:

In the GC mouse model, the MS4A4A recombinant protein markedly enhanced tumor growth (P < 0.001), and the MS4A4A antibody exhibited an inhibitory effect (P < 0.001). MS4A4A recombinant protein decreased the levels of inflammatory cytokine concentrations and increased those of anti-inflammatory mediator concentrations (P < 0.001). By contrast, the MS4A4A antibody treatment group displayed the opposite effect. Inhibition of MS4A4A enhanced the accumulation of macrophages, CD4+ T cells, and CD8+ T cells in the tumor (P < 0.001). Flow cytometry and qRT-PCR analyses showed that MS4A4A promoted M2 macrophage polarization, and MS4A4A antibody induced M1 polarization (P < 0.001). MS4A4A played a key role in inhibiting nuclear factor kappa-light-chain-enhancer of activated B cells subunit p50 (p50) during M1 polarization. Furthermore, the PD-1 antibody reversed the pro-tumor effects of MS4A4A, which reestablished pro-inflammatory cytokine levels while lowering anti-inflammatory cytokines (P < 0.001).

Conclusion:

This study shows that MS4A4A promotes tumor growth by inducing M2 macrophage polarization and suppressing immune responses, while MS4A4A antibody enhances anti-tumor immunity by inducing M1 polarization. PD-1 antibody reverses MS4A4A’s pro-tumor effects, restoring anti-tumor immunity. MS4A4A inhibitors or their combination with PD-1 antibodies may offer a promising strategy for GC immunotherapy.

Keywords

Gastric cancer
Macrophage
Membrane-spanning 4 domains subfamily a member 4A
Tumor microenvironment

INTRODUCTION

Gastric cancer (GC) represents one of the leading types of cancer across the globe, with its incidence and mortality rates ranking among the highest for digestive system tumors.[1,2] Although traditional treatments, such as surgery, radiotherapy, and chemotherapy, improve patient survival rates to some extent, a large portion of GC patients are identified at a late stage, and treatment outcomes remain unsatisfactory.[3-5] Cancer immunotherapy is a promising treatment strategy that mobilizes the patient’s immune response to destroy tumor cells.[6,7] However, the complex immune evasion mechanisms within the tumor microenvironment (TME) of GC often hinder the efficacy of single-agent immunotherapies.[8,9] Therefore, further investigation of the molecular mechanisms regulating immune cell function in the TME for the enhancement of immunotherapy outcomes has become a key research focus.

In the TME, macrophages serve as key immune regulatory cells that play multiple roles in tumor initiation and progression. Tumor-associated macrophages (TAMs) can polarize into different phenotypes, which contributes to either tumor progression or suppression.[10,11] Pro-inflammatory M1 macrophages, through cytokine secretion, can inhibit tumor growth and promote antitumor immune responses, whereas anti-inflammatory M2 macrophages, through the secretion of factors, promote tumor growth and immune evasion.[12-14] Modulation of macrophage polarization can considerably alter the immune characteristics of the TME, which affects tumor growth.[15,16]

Membrane-spanning 4-domains subfamily A member 4A (MS4A4A) is a relatively understudied molecule that belongs to the tetraspanin family.[17,18] Although the expression of MS4A4A in certain immune cells has been reported, its role in tumors remains unclear. Some studies proposed the possible role of MS4A4A in tumor immunoregulation through the modulation of immune cell function; however, the specific mechanisms remain to be elucidated.[17,19] Therefore, MS4A4A can be a potential target for immunotherapy, and its role in the immunoregulation of GC warrants further investigation.

This study was designed to explore the function of MS4A4A in GC, particularly its role in regulating macrophage polarization. Through in vivo and in vitro experiments, we systematically analyzed the effects of MS4A4A on tumor growth, immune cell infiltration, and cytokine expression in GC. Our research revealed that MS4A4A promoted an immunosuppressive state in the TME by inhibiting M1 macrophage polarization, which facilitated tumor growth. In addition, we investigated the effects of MS4A4A inhibitors, along with programmed cell death protein 1 (PD-1) antibodies, to provide new strategies and theoretical support for immunotherapy in GC.

MATERIAL AND METHODS

Animal experiment

Thirty male immunocompetent C57BL/6 mice (6-8 weeks old, 25 ± 2 g) were purchased from Cyagen (Suzhou, China). The human GC cell line MKN-45 was cultured. After reaching the logarithmic growth phase, the cells were passaged and prepared for tumor cell injection. With the use of a sterile syringe, 100 µL GC cell suspension (approximately 1 × 106 cells) was injected subcutaneously into the subscapular region of the mice to form ectopic tumors. The mice were randomly divided into five groups (model, MS4A4A recombinant protein, MS4A4A antibody, PD-1 antibody, and MS4A4A recombinant protein + PD-1 antibody groups) based on a random number table. Tumor volume was measured every 2–3 days using a caliper. Once the tumor reached a size of 100 mm3, the mice received intraperitoneal injections of MS4A4A recombinant protein (ab162515, Abcam, Cambridge, UK) (10 µg/kg), MS4A4A antibody (ab271069, Abcam, Cambridge, UK) (10 µg/kg), PD-1 antibody (CD279, Miltenyi Biotec, Bergisch Gladbach, Germany) (10 µg/kg), or a combination of MS4A4A recombinant protein (10 µg/kg) and PD-1 antibody (10 µg/kg) every other day. Daily injections of saline in equal volumes were administered to the model group. The experiment spanned 3 weeks. At the experiment’s end, the mice were euthanized through intraperitoneal injection of 3% sodium pentobarbital (110 mg/kg) (P3761, Sigma, St. Louis, Missouri, USA), and tumor specimens were harvested for additional analysis. All animal experimentation was carried out following the “Guidelines for Ethical Review of Laboratory Animal Welfare.” This study was approved by the Beijing Maide Kangna Laboratory Animal Welfare Ethics Committee, approval No. MDKN-2024-050.

Fluorescence-activated cell sorting (FACS)

First, a single-cell suspension was sourced from the tumor tissue by cutting the tissue into small pieces and processing it in a digestion solution. Afterward, the cells were filtered through a 40 µm strainer to remove any undigested tissue debris. The extracted primary cells were tested for mycoplasma, and the results were negative. The cells were then counted and resuspended in a cell sorting buffer, followed by the addition of fluorescently labeled antibodies specific to the target immune cell subpopulations. This labeling was completed through cell incubation at 4°C for 30 min to ensure adequate binding. After labeling, the cells were washed through centrifugation and remixed again in the cell sorting buffer. Finally, the labeled cells were sorted using a flow cytometer (FACS Calibur, BD Biosciences, San Jose, California, USA), where appropriate gating was set to select the target immune cell populations (such as macrophages [1:500, AG4753, Beyotime, Shanghai, China], CD4+ T cells [1:500, AG1393, Beyotime, Shanghai, China], CD8+ T cells [1:500, AG1449, Beyotime, Shanghai, China), and B cells [1:500, AG1428, Beyotime, Shanghai, China], etc.), and the sorted cells were collected for subsequent experiments. The expressions of CD86 (1:1000, AG1453, Beyotime, Shanghai, China) and CD206 (1:1000, AG2660, Beyotime, Shanghai, China) were detected. Finally, the proportions of CD86- and CD206-positive cells in different cell subpopulations and their relative expression levels were recorded, and the data were analyzed using flow cytometry software (FACS Diva 8, BD Biosciences, San Jose, California, USA).

Cell culture

Human GC cell line MKN-45 (iCell-h345) and mouse primary bone marrow-derived macrophages (BMDMs) (MIC-iCell-i017) were purchased from Cellverse (Shanghai, China). The GC cells were cultured in RPMI-1640 medium (iCell-0002, Cellverse, Shanghai, China) containing 10% fetal bovine serum (iCell-0500, Cellverse, Shanghai, China) and 1% penicillin-streptomycin (iCell-15140-122, Cellverse, Shanghai, China). BMDMs were cultured in a specialized medium (PriMed-iCell-011, Cellverse, Shanghai, China) for mouse BMDMs. Both cell types were maintained in a 37°C incubator (CB 170, Binder, Tuttlingen, Germany) with 5% carbon dioxide. MKN-45 cells and BMDMs underwent mycoplasma testing with negative results. The MKN-45 cells were also subjected to Short Tandem Repeat profiling, and the BMDMs were confirmed for species identification.

Macrophage polarization

The conditioned medium from MKN-45 cells cultured for 48 h was mixed with BMDMs in the presence of MS4A4A recombinant protein or MS4A4A antibody for 48 h. Cells and supernatants were obtained for further assessment.

Flow cytometry

BMDMs were isolated and prepared into a single-cell suspension. After cell counting, the concentration (1 × 10^6 cells/mL) was determined, and the cells were resuspended in a flow cytometry staining buffer. Then, the cells were incubated with an Fc receptor-blocking solution at 4°C for 10 min. Next, fluorescently labeled antibodies against CD86 (M1 marker) (AG1453, Beyotime, Shanghai, China) and CD206 (M2 marker) (AG2660, Beyotime, Shanghai, China) were added. Finally, the expressions of CD86 and CD206 were detected using a flow cytometer (FACS Calibur, BD Biosciences, San Jose, California, USA), and the percentage of positive cells and their relative expression levels were analyzed utilizing a flow cytometry software (FACS Diva 8, BD Biosciences, San Jose, California, USA).

Enzyme-linked immunosorbent assay (ELISA)

Tissue samples and cell supernatants from different treatments were collected. Interleukin (IL)-23 (PI655), IL-12 (PI530), tumor necrosis factor (TNF)-α (PT512), interferon (IFN)-α (PI508), IL-4 (PI612), IL-13 (PI539), IL-10 (PI522), and transforming growth factor-beta (TGF-β) (PT878) assay kits were purchased. The samples and standards were prepared and diluted in accordance with the experimental requirements. Then, the wash buffer was prepared, antibodies were captured, and substrate reagents were added. The detailed experimental steps were followed in accordance with the manufacturer’s instructions. All the kits used in this section of the experiment were purchased from Beyotime (Shanghai, China).

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

First, total RNA was extracted using TRIzol reagent (R0016, Beyotime, Shanghai, China), and the purity of RNA was ensured. Next, a reverse transcription reaction was performed to convert the extracted RNA into complementary DNA (cDNA) using a reverse transcription kit (KR103, TIANGEN, Beijing, China). Then, a qPCR reaction system was established by mixing the synthesized cDNA with specific primers, a fluorescent dye (SYBR Green), and a qPCR mix (including Taq DNA polymerase, deoxynucleotide triphosphates, magnesium ion, etc.), and the total reaction volume was adjusted to 20 µL. The amplification program was set, including the initial denaturation (95°C for about 30 s), PCR cycles (denaturation, annealing, and extension), which were repeated for 40 cycles while recording the fluorescence signal during each cycle. Finally, the relative expression levels of the target gene were analyzed using the cycle threshold value, which typically involves the 2^(-ΔΔCt) method for normalization. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference. Table 1 lists the sequences involved in this work.

Table 1: Prime sequences.
Prime Names Prime Sequences (5’-3’)
Arg1-F AGCACTGAGGAAAGCTGGTC
Arg1-R TACGTCTCGCAAGCCAATGT
Mgl1-F TCACTGGACGGAGCATGAAG
Mgl1-R TTGAGCAGCTGAAACCACTGA
Fizz1-F AACTGCCTGTGCTTACTCGT
Fizz1-R CAAGAAGCAGGGTAAATGGGC
Ym1-F AGGGCCCTTATTGAGAGGAG
Ym1-R GCACTGTGGAAAAACCGTTGA
iNos-F CAACAGGGAGAAAGCGCAAA
iNos-R TGATGGACCCCAAGCAAGAC
Tnfa-F ACCCTCACACTCACAAACCA
Tnfa-R ACCCTGAGCCATAATCCCCT
Il12b-F ACGGCAGTGTGCTTGTCTAA
Il12b-R ATGGCGAACCTGGATGGTTT
Ccr7-F ATGGACCCAGGTGTGCTTCT
Ccr7-R GCACTGACCAGTGAGCATCT
GAPDH-F TGTCTCCTGCGACTTCAACA
GAPDH-R GGTGGTCCAGGGTTTCTTACT

Arg1: Arginase 1, Mgl1: Macrophage galactose-type lectin 1, Fizz1: Found in inflammatory zone 1, Ym1: Chitinase-like protein 1, iNos: Inducible nitric oxide synthase, Tnfa: Tumor necrosis factor-alpha, Il12b: Interleukin 12 subunit-beta, Ccr7: C-C motif chemokine receptor 7, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine

Hematoxylin and eosin (HE) staining

First, the tumor tissue was fixed with a tissue fixative (IF9010, Solarbio, Beijing, China). The tissue was then cleared with xylene and cut into approximately 5 µm-thick sections. Next, the paraffin sections were deparaffinized in xylene, rehydrated with decreasing concentrations of ethanol, and washed with distilled water. Afterward, the sections were immersed in hematoxylin solution (G1120, Solarbio, Beijing, China) for 5 min for staining. The gentle differentiation was completed using acidic alcohol. Then, the sections were washed again with tap water. Subsequently, the sections were stained with eosin (G1120, Solarbio, Beijing, China) for 5 min and then washed with tap water. They were dehydrated again using increasing concentrations of ethanol and cleared with xylene. After their preparation, the stained sections can be observed under a microscope (BX53, Olympus, Tokyo, Japan) to analyze the morphology and cellular characteristics of the tumor tissue.

Immunofluorescence

The cells were fixed with 4% paraformaldehyde (P1110, Solarbio, Beijing, China) for 10 min to preserve cell morphology. Next, the cells were permeabilized with 0.1% Triton X-100 (T8200, Triton x-100, Solarbio, Beijing, China) for 5 min to allow antibody entry. Then, they were incubated with phosphate-buffered saline (PBS) containing 5% bovine serum albumin (BSA) (SW3015, Solarbio, Beijing, China) at room temperature for 30 min to block non-specific binding. Afterward, primary antibodies labeled with fluorescence against CD86 (ab220188, Abcam, Cambridge, UK), CD206 (ab64693, Abcam, Cambridge, UK), p50 (ab32360, Abcam, Cambridge, UK), and p65 (ab288751, Abcam, Cambridge, UK) were added. Then, the cells were washed thrice with PBS to remove unbound antibodies. Next, the corresponding fluorescently labeled secondary antibodies (ab7064 and ab6717, Abcam, Cambridge, UK) were added. The cells were incubated in the dark at room temperature for 30 min and washed thrice. If necessary, nuclear dyes, such as 4’,6-diamidino-2-phenylindole (C1002, Beyotime, Shanghai, China), were used to stain the cell nuclei. The stained cells were observed using a fluorescence microscope (IX83, Olympus, Tokyo, Japan), the expression levels of CD86, CD206, p50, and p65 were recorded, and ImageJ software (version 1.5f, National Institutes of Health, Bethesda, Maryland, USA) was used to calculate the percentage of positive cells and fluorescence intensity.

Western blot

First, total protein was extracted by the extraction kit (P0013B, Solarbio, Beijing, China), which was supplemented with a protease inhibitor (P1005, Solarbio, Beijing, China) to prevent degradation. Next, the cells were lysed thoroughly through ultrasonic disruption or vortex mixing. Then, polyacrylamide gel was prepared, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (P0012A, Solarbio, Beijing, China) was performed by loading the denatured protein samples into the gel and electrophoresing for about 1 h until the dye front reached the desired position. After electrophoresis, the gel was transferred onto a polyvinylidene fluoride membrane (FFP19, Solarbio, Beijing, China) through electroblotting, and Ponceau S staining was performed to confirm the transfer efficiency. Subsequently, the membrane was blocked at room temperature for 1 h using a blocking buffer containing 5% BSA. Next, primary antibodies (p50 (ab32360, Abcam, Cambridge, UK), p65 (ab32536, Abcam, Cambridge, UK), and GAPDH (ab9485, Abcam, Cambridge, UK) were added, and the cells were incubated overnight at 4 °C, followed by washing of the membrane to remove any unbound primary antibody. Then, a corresponding horse radish peroxidase-conjugated secondary antibody (ab6721, Abcam, Cambridge, UK) was added and incubated for 1 h at room temperature in the dark, followed by another wash to eliminate any unbound secondary antibody. If an enzyme-conjugated secondary antibody was used, then a substrate solution was added for a colorimetric reaction, and the signal was detected using an imaging system. Finally, ImageJ software (version 1.5f, NIH, Bethesda, Maryland, USA) was utilized to analyze the Western blot images.

Statistical analysis

Statistical analysis was performed using GraphPad Prism software (version 1.5f, National Institutes of Health, Bethesda, Maryland, USA). Intergroup data comparison was conducted through t-tests and one-way analysis of variance, followed by Tukey’s post hoc test. Data are presented as mean ± standard deviation. P < 0.05 was considered statistically significant.

RESULTS

MS4A4A inhibition recruits macrophages to enhance immune responses against GC

To understand the function of MS4A4A in the immune response against GC, we compared its effects on GC tumors. The results shown in Figure 1a-c indicate that compared with the model group, MS4A4A recombinant protein significantly increased tumor volume and weight, whereas MS4A4A antibody more effectively reduced tumor volume and weight (P < 0.001). Furthermore, the MS4A4A recombinant protein markedly decreased the levels of pro-inflammatory cytokines IL-23, IL-12, TNF-α, and IFN-α (P < 0.05), and the MS4A4A antibody remarkably increased their levels (P < 0.001) [Figure 1d-g].

MS4A4A inhibition recruits macrophages to enhance immune responses against GC. (a) Representative images of tumors from GC mice following different treatment interventions. Scale bar: 10 mm. (b) Tumor volume. (c) Tumor weight. (d-g) Levels of pro-inflammatory cytokines IL-23 (d), IL-12 (e), TNF-α (f), and IFN-α (g) in tumors measured by ELISA. (h-k) Levels of anti-inflammatory cytokines IL-4 (h), IL-13 (i), IL-10 (j), and TGF-β (k) in tumors measured by ELISA. (l-o) Tumor immune cell subpopulations measured by flow cytometry: macrophages (l), CD4+ T cells (m), CD8+ T cells (n), and B cells (o). n = 6. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, anti-MS4A4A: MS4A4A antibody, IL-23: Interleukin 23, IL-12: Interleukin 12, TNF-α: Tumor necrosis factor-alpha, IFN-α: Interferon-gamma, GC: Gastric cancer, CD4+ (8+) T cells: Cluster of differentiation 4 (8) positive T cells, TGF-β: Transforming growth factor-beta, ELISA: Enzyme-linked immunosorbent assay.
Figure 1:
MS4A4A inhibition recruits macrophages to enhance immune responses against GC. (a) Representative images of tumors from GC mice following different treatment interventions. Scale bar: 10 mm. (b) Tumor volume. (c) Tumor weight. (d-g) Levels of pro-inflammatory cytokines IL-23 (d), IL-12 (e), TNF-α (f), and IFN-α (g) in tumors measured by ELISA. (h-k) Levels of anti-inflammatory cytokines IL-4 (h), IL-13 (i), IL-10 (j), and TGF-β (k) in tumors measured by ELISA. (l-o) Tumor immune cell subpopulations measured by flow cytometry: macrophages (l), CD4+ T cells (m), CD8+ T cells (n), and B cells (o). n = 6. P < 0.05, P < 0.01, P < 0.001. MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, anti-MS4A4A: MS4A4A antibody, IL-23: Interleukin 23, IL-12: Interleukin 12, TNF-α: Tumor necrosis factor-alpha, IFN-α: Interferon-gamma, GC: Gastric cancer, CD4+ (8+) T cells: Cluster of differentiation 4 (8) positive T cells, TGF-β: Transforming growth factor-beta, ELISA: Enzyme-linked immunosorbent assay.

Regarding anti-inflammatory cytokines, MS4A4A recombinant protein markedly increased the levels of IL-4, IL-13, IL-10, and TGF-β (P < 0.001), whereas the MS4A4A antibody significantly reduced these levels (P < 0.001) [Figure 1h-k]. Analysis of tumor immune subpopulations revealed the remarkably reduced accumulation of macrophages, CD4+ T cells, and CD8+ T cells in tumor tissue in the MS4A4A recombinant protein-treated group (P < 0.05), and the treatment with the MS4A4A antibody resulted in a notable increase in the accumulation of these immune cells in the tumor tissue (P < 0.001) [Figure 1l-n]. However, there were no changes in B-cell accumulation after different treatments [Figure 1o].

MS4A4A inhibition induces M1 macrophage polarization

We investigated how MS4A4A regulates macrophage antitumor activity. Flow cytometry analysis showed the effect of MS4A4A on macrophage phenotype polarization within the tumor. Figures 2a-c demonstrate that compared with the model group, MS4A4A treatment promoted macrophage polarization to the CD206+ M2 phenotype (P < 0.05), while MS4A4A antibody treatment induced macrophage polarization to the CD86+ M1 phenotype (P < 0.001).

MS4A4A inhibition induces M1 macrophage polarization. (a-c) Flow cytometry analysis of the proportions of M1 (CD86) and M2 (CD206) macrophages. (d-k) qRT-PCR analysis of mRNA levels of Arg1, Mgl1, Fizz1, Ym1, iNos, Tnfa, Il12b, and Ccr7 in tumor tissues. (l) HE staining of tumor tissues. Scale bar: 100 µm (100×). n = 6. ✶P < 0.05, ✶✶✶P < 0.001. MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, CD86 (206): Cluster of differentiation 86 (206), Arg1: Arginase 1; Mgl1: Macrophage galactose-type lectin 1, Fizz1: Found in inflammatory zone 1, Ym1: Chitinase-like protein 1, iNos: Inducible nitric oxide synthase, Tnfa: Tumor necrosis factor-alpha, Il12b: Interleukin 12 subunit-beta, Ccr7: C-C motif chemokine receptor 7, HE staining: Hematoxylin and eosin staining, mRNA: Messenger RNA, qRT-PCR: Quantitative reverse transcription polymerase chain reaction.
Figure 2:
MS4A4A inhibition induces M1 macrophage polarization. (a-c) Flow cytometry analysis of the proportions of M1 (CD86) and M2 (CD206) macrophages. (d-k) qRT-PCR analysis of mRNA levels of Arg1, Mgl1, Fizz1, Ym1, iNos, Tnfa, Il12b, and Ccr7 in tumor tissues. (l) HE staining of tumor tissues. Scale bar: 100 µm (100×). n = 6. P < 0.05, P < 0.001. MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, CD86 (206): Cluster of differentiation 86 (206), Arg1: Arginase 1; Mgl1: Macrophage galactose-type lectin 1, Fizz1: Found in inflammatory zone 1, Ym1: Chitinase-like protein 1, iNos: Inducible nitric oxide synthase, Tnfa: Tumor necrosis factor-alpha, Il12b: Interleukin 12 subunit-beta, Ccr7: C-C motif chemokine receptor 7, HE staining: Hematoxylin and eosin staining, mRNA: Messenger RNA, qRT-PCR: Quantitative reverse transcription polymerase chain reaction.

Next, we measured the expressions of M1 and M2 markers through qRT-PCR. Figures 2d-g show that MS4A4A treatment remarkably increased the messenger RNA (mRNA) levels of Arginase 1 (Arg1), macrophage galactose-type lectin 1 (Mgl1) found in inflammatory zone 1 (Fizz1), and Chitinase-like protein 1 (Ym1) (P < 0.001), while MS4A4A antibody treatment notably decreased the mRNA levels of these markers (P < 0.001). Figures 2h-k demonstrate that MS4A4A treatment significantly downregulated the mRNA expressions of inducible nitric oxide synthase (iNos), tumor necrosis factor-alpha (Tnfa), interleukin 12 subunit-beta (Il12b), and C-C motif chemokine receptor 7 (Ccr7) (P < 0.001), whereas MS4A4A antibody treatment resulted in their significant upregulation (P < 0.001).

Finally, we examined the effects of different MS4A4A treatments on tumor tissue pathology through HE staining. Figure 2l shows that the MS4A4A antibody treatment severely disrupted tumor tissue morphology, which resulted in disorganized cytoplasmic structures, ruptured cell membranes, and large areas of cell death. By contrast, MS4A4A treatment promoted tumor cell proliferation with abundant mitotic figures.

MS4A4A inhibition induces M1 macrophage polarization in vitro

In addition to in vivo studies, we further evaluated the effect of MS4A4A on macrophage polarization in vitro. Mouse BMDMs were incubated with the MS4A4A recombinant protein, MS4A4A antibody, or solvent in an MKN-45 cell culture medium for 48 h. The MKN-45 cell culture medium was used to simulate the GC microenvironment in vitro. Figures 3a-c show that compared with the control group, the MS4A4A recombinant protein noticeably reduced the CD86/CD206 ratio, and MS4A4A antibody treatment caused its significant increase (P < 0.001). These results suggest that the MS4A4A recombinant protein promoted the differentiation of BMDMs into pro-tumorigenic M2 macrophages, whereas the MS4A4A antibody promoted their differentiation into anti-tumorigenic M1 macrophages. Immunofluorescence further confirmed that MS4A4A decreased the expression of CD86 and increased that of CD206 expression; the MS4A4A antibody increased CD86 expression and decreased CD206 expression (P < 0.001) [Figure 3d-f].

MS4A4A inhibition induces M1 macrophage polarization in vitro. (a-c) Mouse BMDMs were treated with MKN-45 cell culture medium in the presence of MS4A4A recombinant protein or MS4A4A antibody. Flow cytometry was used to measure the proportions of M1 (CD86) and M2 (CD206) macrophages. (d-f) Immunofluorescence was used to detect the expressions of CD86 and CD206 in BMDMs. Scale bar: 50 µm (200×). n = 6. ✶✶✶P < 0.001. DAPI: 4’,6-Diamidino-2-phenylindole, MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, BMDMs: Bone marrow-derived macrophages.
Figure 3:
MS4A4A inhibition induces M1 macrophage polarization in vitro. (a-c) Mouse BMDMs were treated with MKN-45 cell culture medium in the presence of MS4A4A recombinant protein or MS4A4A antibody. Flow cytometry was used to measure the proportions of M1 (CD86) and M2 (CD206) macrophages. (d-f) Immunofluorescence was used to detect the expressions of CD86 and CD206 in BMDMs. Scale bar: 50 µm (200×). n = 6. P < 0.001. DAPI: 4’,6-Diamidino-2-phenylindole, MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, BMDMs: Bone marrow-derived macrophages.

Next, we measured IL-12 and IL-10 levels through ELISA. Results reveal that the MS4A4A recombinant protein significantly reduced IL-12 levels and increased those of IL-10. Meanwhile, the MS4A4A antibody significantly increased IL-12 levels and reduced those of IL-10 (P < 0.001) [Figure 4a and b]. These findings suggest that MS4A4A treatment promoted M2 polarization. Subsequently, we measured the expressions of M1 and M2 markers through qRT-PCR. Figures 4c-j indicate that after MS4A4A treatment, Arg1, Mgl1, Fizz1, and Ym1 mRNA levels significantly increased (P < 0.001), and MS4A4A antibody treatment caused their significant decrease (P < 0.001). Figures 4c-j show that MS4A4A treatment significantly downregulated the mRNA expressions of iNos, Tnfa, Il12b, and Ccr7 (P < 0.001), whereas MS4A4A antibody treatment resulted in their significant upregulation (P < 0.001).

MS4A4A regulates the levels of inflammatory cytokines and the expression of polarization-related genes in BMDMs. (a and b) ELISA was performed to measure the levels of IL-12 and IL-10 in the supernatant of BMDMs. (c-j) qRT-PCR was used to assess the mRNA levels of Arg1, Mgl1, Fizz1, Ym1, iNos, Tnfa, Il12b, and Ccr7 in BMDMs. n = 6. ✶✶P < 0.01, ✶✶✶P < 0.001. MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, BMDMs: Bone marrow-derived macrophages, ELISA: Enzyme-linked immunosorbent assay, qRT-PCR: Quantitative reverse transcription polymerase chain reaction, mRNA: Messenger RNA, Arg1: Arginase 1; Mgl1: Macrophage galactose-type lectin 1, Fizz1: Found in inflammatory zone 1, Ym1: Chitinase-like protein 1, iNos: Inducible nitric oxide synthase, Tnfa: Tumor necrosis factor-alpha, Il12b: Interleukin 12 subunit-beta, Ccr7: C-C motif chemokine receptor 7.
Figure 4:
MS4A4A regulates the levels of inflammatory cytokines and the expression of polarization-related genes in BMDMs. (a and b) ELISA was performed to measure the levels of IL-12 and IL-10 in the supernatant of BMDMs. (c-j) qRT-PCR was used to assess the mRNA levels of Arg1, Mgl1, Fizz1, Ym1, iNos, Tnfa, Il12b, and Ccr7 in BMDMs. n = 6. P < 0.01, P < 0.001. MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, BMDMs: Bone marrow-derived macrophages, ELISA: Enzyme-linked immunosorbent assay, qRT-PCR: Quantitative reverse transcription polymerase chain reaction, mRNA: Messenger RNA, Arg1: Arginase 1; Mgl1: Macrophage galactose-type lectin 1, Fizz1: Found in inflammatory zone 1, Ym1: Chitinase-like protein 1, iNos: Inducible nitric oxide synthase, Tnfa: Tumor necrosis factor-alpha, Il12b: Interleukin 12 subunit-beta, Ccr7: C-C motif chemokine receptor 7.

MS4A4A inhibition probably induces M1 polarization by suppressing p50 nuclear factor-kappa B (NF-κb)

We then delved into the molecular mechanism by which MS4A4A induced macrophage polarization. We examined the expressions of p65 and p50 in BMDMs through immunofluorescence and Western blot. The results in Figure 5a-f show that compared with the control group, MS4A4A treatment notably reduced p65 expression (P < 0.001) and increased p50 expression in BMDMs (P < 0.001). By contrast, MS4A4A antibody treatment notably increased p65 expression (P < 0.001) and reduced p50 expression in BMDMs (P < 0.001).

MS4A4A inhibition may induce M1 polarization by suppressing p50 NF-κB. (a-c) Mouse BMDMs were treated with MKN-45 cell culture medium in the presence of MS4A4A recombinant protein or MS4A4A antibody. Immunofluorescence was used to measure p65 and p50 expressions in BMDMs. Scale bar: 50 µm (200×). (d-f) Western blot was used to assess the protein expressions of p65 and p50 in BMDMs. n = 6. ✶✶✶P < 0.001. MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, NF-κB: Nuclear factor-kappa B, BMDMs: Bone marrow-derived macrophages, p65: Nuclear factor-kappa B subunit 65, p50: Nuclear factor-kappa B subunit 1.
Figure 5:
MS4A4A inhibition may induce M1 polarization by suppressing p50 NF-κB. (a-c) Mouse BMDMs were treated with MKN-45 cell culture medium in the presence of MS4A4A recombinant protein or MS4A4A antibody. Immunofluorescence was used to measure p65 and p50 expressions in BMDMs. Scale bar: 50 µm (200×). (d-f) Western blot was used to assess the protein expressions of p65 and p50 in BMDMs. n = 6. P < 0.001. MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, NF-κB: Nuclear factor-kappa B, BMDMs: Bone marrow-derived macrophages, p65: Nuclear factor-kappa B subunit 65, p50: Nuclear factor-kappa B subunit 1.

PD-1 antibody reverses the tumor-promoting effect of MS4A4A on GC

The results in Figures 6a-c reveal that compared with the model group, MS4A4A treatment significantly promoted tumor growth (P < 0.001), and the addition of PD-1 antibody significantly reduced the tumor-promoting effect induced by MS4A4A (P < 0.001). Figures 6d-g indicate that the MS4A4A recombinant protein significantly decreased the mRNA expression levels of Ifng and Tnfa, and increased those of Il10 and Tgfb (P < 0.001). However, the addition of PD-1 antibody notably increased the mRNA expressions of Ifng and Tnfa, while decreasing the expression of Il10 and Tgfb (P < 0.001). In addition, we measured the levels of IFN-α, TNF-α, IL-10, and TGF-β through ELISA. The findings in Figure 6h-k demonstrate that the MS4A4A recombinant protein significantly lowered the levels of IFN-α and TNF-α and increased those of IL-10 and TGF-β (P < 0.001). The addition of PD-1 antibody effectively reversed the effects of MS4A4A, which resulted in increased IFN-α and TNF-α levels and reduced IL-10 and TGF-β levels (P < 0.001).

PD-1 antibody reverses the tumor-promoting effect of MS4A4A on GC. (a) Representative images of tumors from GC mice after different treatments. Scale bar: 10 mm. (b) Tumor volume. (c) Tumor weight. (d-g) mRNA levels of Ifng, Tnfa, Il10, and Tgfb in tumor tissues measured by qRT-PCR. (h-k) Levels of IFN-α, TNF-α, IL-10, and TGF-β in tumor tissues measured through ELISA. n = 6. ✶P < 0.05, ✶✶✶P < 0.001. PD-1: Programmed cell death protein 1, MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, GC: Gastric cancer, mRNA: Messenger RNA, Ifng: Interferon-gamma Tnfa: Tumor necrosis factor-alpha, Il10: Interleukin 10, TGF-β: Transforming growth factor-beta, ELISA: Enzyme-linked immunosorbent assay.
Figure 6:
PD-1 antibody reverses the tumor-promoting effect of MS4A4A on GC. (a) Representative images of tumors from GC mice after different treatments. Scale bar: 10 mm. (b) Tumor volume. (c) Tumor weight. (d-g) mRNA levels of Ifng, Tnfa, Il10, and Tgfb in tumor tissues measured by qRT-PCR. (h-k) Levels of IFN-α, TNF-α, IL-10, and TGF-β in tumor tissues measured through ELISA. n = 6. P < 0.05, P < 0.001. PD-1: Programmed cell death protein 1, MS4A4A: Membrane-spanning 4-domains subfamily A member 4A, GC: Gastric cancer, mRNA: Messenger RNA, Ifng: Interferon-gamma Tnfa: Tumor necrosis factor-alpha, Il10: Interleukin 10, TGF-β: Transforming growth factor-beta, ELISA: Enzyme-linked immunosorbent assay.

DISCUSSION

This study thoroughly explored the role of MS4A4A in the immune response of GC, which reveals its critical function in regulating macrophage polarization and influencing TME. By inhibiting MS4A4A, we considerably enhanced the antitumor immune response and provided new insights into MS4A4A as a potential target for GC immunotherapy. First, the role of MS4A4A in the regulation of macrophage polarization is consistent with previous findings regarding TAMs. M1 macrophages exert antitumor effects by secreting pro-inflammatory cytokines, and M1 macrophages promote tumor progression by secreting anti-inflammatory factors.[20-22] Our results indicate that MS4A4A treatment led to the polarization of macrophages toward the M2 phenotype, whereas MS4A4A antibody treatment reversed this effect and transformed macrophages into the M1 phenotype. This outcome presents a strong contrast to those of other studies on the relationship between macrophage polarization and tumor progression and further demonstrates that regulation of the polarization state of TAMs can influence the immune characteristics of the TME.[17,23]

Second, the effect of MS4A4A on immune cell infiltration is consistent with those of other studies on immune evasion. We observed that MS4A4A treatment considerably reduced the infiltration of CD4+ T cells, CD8+ T cells, and macrophages in tumor tissues, which suggests that MS4A4A may promote tumor immune evasion by inhibiting the infiltration of immune cells. This finding aligns with those of previous research on the immunosuppressive role of PD-L1 in GC, which also indicated that tumors evade immune system attack by suppressing the infiltration of effector T cells.[9,24,25] However, unlike PD-L1, MS4A4A primarily regulates macrophage polarization rather than directly affecting T-cell function. Therefore, the immunoregulatory effects of MS4A4A may influence T-cell activity through indirect pathways, which further supports its potential as a target for tumor immunotherapy.

Another important finding in our study is that MS4A4A probably regulates macrophage polarization through the NF-κB signaling pathway. The NF-κB pathway plays a central role in tumor immunity, particularly in the processes of inflammation and immune cell activation.[26-28] In our experiments, MS4A4A treatment substantially decreased the expression of p65 and increased that of p50, which implies that MS4A4A may promote M2 polarization by inhibiting the classical NF-κB pathway. This finding is consistent with those of other studies on the roles of p50 and p65 in the regulation of M1/M2 polarization, which further supports the critical role of NF-κB in the regulation of macrophage function by MS4A4A.[29-31]

The effect of PD-1 antibody on the reversal of the pro-tumor effects of MS4A4A further enhances our understanding of immune checkpoint blockade therapies. Blockage of the PD-1/PD-L1 pathway tremendously improved immune responses in various tumor types.[32,33] Our results indicate that the PD-1 antibody effectively reversed the immune suppression induced by MS4A4A, which restored the expressions of pro-inflammatory cytokines IFN-α and TNF-α and reduced the levels of anti-inflammatory cytokines IL-10 and TGF-β. This finding is consistent with that of existing research on the role of PD-1 blockade in enhancing T-cell function and alleviating immune suppression.[34] Furthermore, the combination of PD-1 antibody with MS4A4A inhibitors presents a promising strategy for immunotherapy in GC.

The limitations of this study included the following: the use of the MKN-45 cell line alone, which does not fully reflect the heterogeneity of GC; the use of a C57BL/6 mouse model, which differs from the human TME and thus limits clinical translation; the focus on macrophage M1/M2 polarization while neglecting the role of other immune cells; the lack of in-depth analysis of other relevant signaling pathways; the absence of clinical validation in human patients; the assessment of short-term effects only; and disregarding long-term and potential side effects. Addressing these issues would help further gain insights into the role of MS4A4A in GC and its potential as a therapeutic target. Future studies should explore MS4A4A’s role in other cancer types beyond GC to assess its generalizability and potential as a therapeutic target in various TMEs. In addition, investigation of combination therapies with different immunomodulators, such as immune checkpoint inhibitors, cytokine-based therapies, or adoptive cell therapies, can further enhance the efficacy of MS4A4A inhibition in cancer treatment. Furthermore, studies should explore the molecular mechanisms underlying MS4A4A-mediated macrophage polarization, including its interaction with other key signaling pathways, to uncover new therapeutic targets and strategies. Finally, clinical trials assessing the safety, efficacy, and potential of biomarkers for the prediction of treatment response to MS4A4A inhibitors, either alone or in combination with other immunotherapies, will be crucial for the translation of these findings into clinical practice.

In conclusion, the role of MS4A4A in immune regulation in GC provides new insights into its potential as a therapeutic target. Compared with previous studies, our research not only confirms the importance of macrophage polarization in the regulation of the TME but also reveals the possible complex interactions of MS4A4A with the NF-κB and PD-1 pathways.

SUMMARY

MS4A4A influences the immune response in the TME by regulating the polarization state of macrophages, which promotes the progression of GC. The inhibition of MS4A4A probably enhances antitumor immune responses and reverses the immune suppressive effects induced by MS4A4A through the regulation of the NF-κB signaling pathway and the immune checkpoint PD-1.

AVAILABILITY OF DATA AND MATERIALS

The data that support the findings of this study are available from the corresponding author on reasonable request.

ABBREVIATIONS

anti-MS4A4A: MS4A4A antibody

Arg1: Arginase 1

Ccr7: C-C Motif Chemokine Receptor 7

CD4+ (8+) T cells: Cluster of Differentiation 4 (8) Positive T Cells

CD86 (206): Cluster of Differentiation 86 (206)

DAPI: 4’,6-Diamidino-2-phenylindole

Fizz1: Found in Inflammatory Zone 1

GC: Gastric Cancer

HE staining: Hematoxylin and Eosin Staining

IFN-γ: Interferon-Gamma

IL-12: Interleukin 12

Il12b: Interleukin 12 Subunit-Beta

IL-23: Interleukin 23

iNos: Inducible Nitric Oxide Synthase

Mgl1: Macrophage Galactose-Type Lectin 1

MS4A4A: Membrane Spanning 4-Domains A4A

p50: Nuclear Factor Kappa B Subunit 1

p65: Nuclear Factor Kappa B Subunit 65

Tnfa: Tumor Necrosis Factor-Alpha

TNF-α: Tumor Necrosis Factor-Alpha

Ym1: Chitinase-like Protein 1

AUTHOR CONTRIBUTIONS

XYZ: Conducted the research and contributed to data analysis and interpretation of the results; DN: Provided assistance and suggestions for the experiments. All authors participated in the drafting and critical revision of the manuscript. All authors have read and approved the final manuscript. All authors were fully involved in the work, able to take public responsibility for relevant portions of the content, and agreed to be accountable for all aspects of the work, ensuring that any questions related to its accuracy or integrity are addressed. All authors are eligible for ICMJE authorship.

ACKNOWLEDGMENT

Not applicable.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

This study was approved by Beijing Maide Kangna Laboratory Animal Welfare Ethics Committee, approval No. MDKN-2024-050; 2024.05.30. Informed consent from patients is not required as this study does not involve human experiments.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

EDITORIAL/PEER REVIEW

To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.

FUNDING: Not applicable.

References

  1. , . Gastric cancer screening in Western countries: A call to action. Dig Liver Dis. 2024;56:1653-62.
    [CrossRef] [PubMed] [Google Scholar]
  2. , . Gastric cancer immunosuppressive microenvironment heterogeneity: Implications for therapy development. Trends Cancer. 2024;10:627-42.
    [CrossRef] [PubMed] [Google Scholar]
  3. , , , , . Gastric cancer: Epidemiology, risk factors, classification, genomic characteristics and treatment strategies. Int J Mol Sci. 2020;21:4012.
    [CrossRef] [PubMed] [Google Scholar]
  4. , , . Gastric cancer treatment: Recent progress and future perspectives. J Hematol Oncol. 2023;16:57.
    [CrossRef] [PubMed] [Google Scholar]
  5. , . Current treatment and recent progress in gastric cancer. CA Cancer J Clin. 2021;71:264-79.
    [CrossRef] [PubMed] [Google Scholar]
  6. , , , , , . Identification of lactylation related model to predict prognostic, tumor infiltrating immunocytes and response of immunotherapy in gastric cancer. Front Immunol. 2023;14:1149989.
    [CrossRef] [PubMed] [Google Scholar]
  7. , , , , , , et al. Tumor microenvironment evaluation promotes precise checkpoint immunotherapy of advanced gastric cancer. J Immunother Cancer. 2021;9:e002467.
    [CrossRef] [PubMed] [Google Scholar]
  8. , , , , , , et al. DKK1 Promotes tumor immune evasion and impedes anti-PD-1 treatment by inducing immunosuppressive macrophages in gastric cancer. Cancer Immunol Res. 2022;10:1506-24.
    [CrossRef] [PubMed] [Google Scholar]
  9. , , , , , , et al. TRIM28 promotes the escape of gastric cancer cells from immune surveillance by increasing PD-L1 abundance. Signal Transduct Target Ther. 2023;8:246.
    [CrossRef] [PubMed] [Google Scholar]
  10. , , , . Tumor-associated macrophages in tumor immunity. Front Immunol. 2020;11:583084.
    [CrossRef] [PubMed] [Google Scholar]
  11. , , . Shaping polarization of tumor-associated macrophages in cancer immunotherapy. Front Immunol. 2022;13:888713.
    [CrossRef] [PubMed] [Google Scholar]
  12. , , , . M1 macrophage exosomes engineered to foster M1 polarization and target the IL-4 receptor inhibit tumor growth by reprogramming tumor-associated macrophages into M1-like macrophages. Biomaterials. 2021;278:121137.
    [CrossRef] [PubMed] [Google Scholar]
  13. , , , , , , et al. d-lactate modulates M2 tumor-associated macrophages and remodels immunosuppressive tumor microenvironment for hepatocellular carcinoma. Sci Adv. 2023;9:eadg2697.
    [CrossRef] [PubMed] [Google Scholar]
  14. , , , . Macrophage M1/M2 polarization. Eur J Pharmacol. 2020;877:173090.
    [CrossRef] [PubMed] [Google Scholar]
  15. , , . Diversity, mechanisms, and significance of macrophage plasticity. Annu Rev Pathol. 2020;15:123-47.
    [CrossRef] [PubMed] [Google Scholar]
  16. , , , , , . Vinblastine resets tumor-associated macrophages toward M1 phenotype and promotes antitumor immune response. J Immunother Cancer. 2023;11:e007253.
    [CrossRef] [PubMed] [Google Scholar]
  17. , . MS4A4A regulates arginase 1 induction during macrophage polarization and lung inflammation in mice. Eur J Immunol. 2020;50:1602-5.
    [CrossRef] [PubMed] [Google Scholar]
  18. , , , , , , et al. Targeting MS4A4A: A novel pathway to improve immunotherapy responses in glioblastoma. CNS Neurosci Ther. 2024;30:e14791.
    [CrossRef] [PubMed] [Google Scholar]
  19. , , , , , , et al. Targeting MS4A4A on tumour-associated macrophages restores CD8+ T-cell-mediated antitumour immunity. Gut. 2023;72:2307-20.
    [CrossRef] [PubMed] [Google Scholar]
  20. , , , , , . Metabolism, metabolites, and macrophages in cancer. J Hematol Oncol. 2023;16:80.
    [CrossRef] [PubMed] [Google Scholar]
  21. , . Metabolic regulation of macrophage polarization in cancer. Trends Cancer. 2019;5:822-34.
    [CrossRef] [PubMed] [Google Scholar]
  22. , , , , , . Engineering macrophages for cancer immunotherapy and drug delivery. Adv Mater. 2020;32:e2002054.
    [CrossRef] [PubMed] [Google Scholar]
  23. , , , , , , et al. GBP2 promotes M1 macrophage polarization by activating the notch1 signaling pathway in diabetic nephropathy. Front Immunol. 2023;14:1127612.
    [CrossRef] [PubMed] [Google Scholar]
  24. , , , . The Anti-PD-1/PDL1 immunotherapy for gastric esophageal cancer: A systematic review and meta-analysis and literature review. Cancer Control. 2021;28 Available from:
    [CrossRef] [PubMed] [Google Scholar]
  25. , , , , , , et al. PDL1: Biological mechanism, function, and immunotherapy in gastric cancer. Front Immunol. 2022;13:1060497.
    [CrossRef] [PubMed] [Google Scholar]
  26. , , , , , , et al. CECR2 drives breast cancer metastasis by promoting NF-κB signaling and macrophage-mediated immune suppression. Sci Transl Med. 2022;14:eabf5473.
    [CrossRef] [PubMed] [Google Scholar]
  27. , , , , . Metformin activates AMPK/SIRT1/NF-κB pathway and induces mitochondrial dysfunction to drive caspase3/GSDME-mediated cancer cell pyroptosis. Cell Cycle. 2020;19:1089-104.
    [CrossRef] [PubMed] [Google Scholar]
  28. , , , , , , et al. Targeting Plk1 sensitizes pancreatic cancer to immune checkpoint therapy. Cancer Res. 2022;82:3532-48.
    [CrossRef] [PubMed] [Google Scholar]
  29. , , , , , , et al. RACK1 promotes cancer progression by increasing the M2/M1 macrophage ratio via the NF-κB pathway in oral squamous cell carcinoma. Mol Oncol. 2020;14:795-807.
    [CrossRef] [PubMed] [Google Scholar]
  30. , , , , , . Curcumin inhibits LPS-induced neuroinflammation by promoting microglial M2 polarization via TREM2/TLR4/NF-?κB pathways in BV2 cells. Mol Immunol. 2019;116:29-37.
    [CrossRef] [PubMed] [Google Scholar]
  31. , , , , , , et al. Activation of RARα Receptor attenuates neuroinflammation after SAH via promoting M1-to-M2 phenotypic polarization of microglia and regulating Mafb/Msr1/PI3K-Akt/NF-κB pathway. Front Immunol. 2022;13:839796.
    [CrossRef] [PubMed] [Google Scholar]
  32. , , . Roles of PD-1/PD-L1 pathway: Signaling, cancer, and beyond. Adv Exp Med Biol. 2020;1248:33-59.
    [CrossRef] [PubMed] [Google Scholar]
  33. , , , , , . Combination strategies with PD-1/PD-L1 blockade: Current advances and future directions. Mol Cancer. 2022;21:28.
    [CrossRef] [PubMed] [Google Scholar]
  34. , , , , , , et al. Functional HPV-specific PD-1(+) stem-like CD8 T cells in head and neck cancer. Nature. 2021;597:279-84.
    [CrossRef] [PubMed] [Google Scholar]
Show Sections