Translate this page into:
MicroRNA-15a-5p suppresses triple-negative breast cancer cell proliferation and invasion by modulating T-cell immunoreceptor associated with immunoglobulin and ITIM domain expression

*Corresponding author: Limin Wei, Department of Breast Oncology Surgery, The First Affiliated Hospital of Henan University of Science and Technology, Luoyang City, China. 13783100995@163.com
-
Received: ,
Accepted: ,
How to cite this article: Feng S, Song Y, Cui J, Wu Z, Wei L. MicroRNA-15a-5p suppresses triple-negative breast cancer cell proliferation and invasion by modulating T-cell immunoreceptor associated with immunoglobulin and ITIM domain expression. CytoJournal. 2026;23:6. doi: 10.25259/Cytojournal_40_2025
Abstract
Objective:
Treating triple-negative breast cancer (TNBC) is a major challenge owing to its unique biological characteristics. This study aimed to elucidate the molecular interaction between microRNA-15a-5p and T-cell immunoreceptor associated with immunoglobulin and ITIM domains (TIGIT) in TNBC.
Material and Methods:
The GSE22513 microarray dataset was subjected to bioinformatic analysis. MDA-MB-231 and MDA-MB-468 cells were transfected with lentiviral constructs for overexpressing TIGIT and microRNA (miRNA) mimics for overexpressing miR-15a-5p. Western blot and quantitative real-time polymerase chain reaction analyses were conducted to quantify TIGIT and miR-15a-5p levels of pre- and post-transfection. Cell proliferation, migration, invasiveness, cell cycle distribution, and apoptosis were assessed using cell counting kit-8, wound-healing, colony formation, transwell assays, and flow cytometry, respectively.
Results:
This study identified 139 genes (37 upregulated and 102 downregulated genes). Elevated TIGIT levels exhibited a significant link to unfavorable outcomes in individuals with breast cancer (BC). Additional analyses demonstrated that TIGIT expression in BC cell lines was substantially increased compared with that in normal breast cells. Overexpressing miR-15a-5p effectively inhibited TIGIT expression and consequently suppressed TNBC cell proliferation, invasion, and migration. This inhibition prompted G2/M phase accumulation and enhanced cellular mortality.
Conclusion:
miR-15a-5p exerts tumor-suppressive effects through TIGIT downregulation, thereby mitigating the malignant phenotype of TNBC.
Keywords
Bioinformatics
microRNA-15a-5p
Proliferation
T-cell immunoreceptor associated with immunoglobulin Ig and ITIM domains
Triple-negative breast cancer
INTRODUCTION
Breast cancer (BC) contributes significantly to cancer incidence, disability, and mortality among women globally.[1] Triple-negative breast cancer (TNBC) constitutes 15–20% of BC cases and is distinguished by an absence of receptors, namely estrogen, progesterone, and epidermal growth factor receptor 2, resulting in high levels of aggression and malignancy.[2] At present, TNBC is mainly treated by chemotherapy and immunotherapy.[3] However, these therapeutic strategies have several limitations. Chemotherapeutic agents are associated with drug resistance and side effects. Meanwhile, programmed cell death protein-1 (PD-1)/programmed death-ligand-1 (PD-L1) inhibitors exhibit low response rates as monotherapy.[4] TNBC exhibits a higher likelihood of reoccurrence and diminished survival outcomes, while its molecular mechanisms remain incompletely understood. Consequently, discovering new molecular targets for TNBC treatment is imperative to advance effective diagnostic and therapeutic approaches.
MicroRNAs (miRNAs), which are non-coding RNAs with a size of 20–25 nucleotides, modulate translation through interactions with the 3-untranslated regions of target transcripts.[5] Previous studies demonstrated that miRNAs mediate various cancer-related biological functions, including cancer cell proliferation, migration, and invasiveness, and function as oncogenes or tumor suppressors.[6-8] A single miRNA can regulate the expression of several genes, while a single target gene may contain several miRNA binding sites. Thus, the interaction between miRNAs and their target genes influences tumor cell proliferation and invasion.[9] miRNAs can serve as stable and specific biomarkers and have prognostic value in TNBC. For example, the downregulated expression of miR-155 predicts poor survival.[10] In addition, miRNAs have several advantages as a therapeutic target because they regulate multiple targets and mitigate drug resistance. At present, several miRNA-based therapeutics have progressed to phase II clinical trials.[11] Combining immunotherapy and dynamic monitoring technologies will enhance the clinical value of miRNAs. Accumulating investigations indicate that miR-15a-5p is implicated in diverse malignancies, such as cholangiocarcinoma,[12] non-small cell colon cancer,[13] lung cancer,[14] and BC.[15] Yuan et al.[16] revealed that miR-15a-5p upregulation mitigates doxorubicin resistance in BC cells, thereby inhibiting the proliferation, invasion, and migration of cancer cells.[17] Moreover, the downregulation of miR-15a-5p in BC cells is suggested to promote AKT3-dependent cancer cell multiplication, movement, and invasion.[18,19] Overall, these observations emphasize the significant influence of miR-15a-5p across various cancers.
T-cell immunoreceptor associated with immunoglobulin (Ig) and ITIM domains (TIGIT) represents a newly identified immune checkpoint molecule that, similar to other molecules encompassing PD-1 and LAG-3, imposes a negative regulatory effect on the immune system. TIGIT is predominantly expressed in lymphocytes and is a potential immunotherapeutic target. TIGIT mediates immune suppression by interacting with CD155 to hinder the cytotoxic capabilities of T lymphocytes and natural killer (NK) cells. This interaction triggers inhibitory signaling cascades that suppress cytotoxic responses and establish immunosuppressive microenvironments.[20] Notably, TIGIT is not only overexpressed in immune cells but also upregulated in colorectal cancer and TNBC.[21,22] In addition, TIGIT is involved in the progression of several cancers, such as melanoma,[23] lung cancer,[24] gastric cancer,[25] acute myeloid leukemia,[26] and multiple myeloma.[27] The invasion, proliferation, and immunosuppression of BC cells are modulated by various genes, including TIGIT.[28] The value of TIGIT-targeting miRNAs, especially their regulatory mechanisms, in TNBC is unclear. Further exploration of the specific interactions between miRNAs and their target genes is imperative to enhance our understanding of TNBC.
In this study, gene expression data were procured from the Gene Expression Omnibus (GEO) database and analyzed using R. Through the application of bioinformatic tools, we hypothesized that miR-15a-5p may directly target TIGIT, thereby suppressing TNBC. This hypothesis was experimentally validated. Results will contribute to the knowledge of the functions of miR-15a-5p and TIGIT in TNBC.
MATERIAL AND METHODS
Data collection and differentially expressed gene (DEG) analysis
The expression data from the GSE22513 RNA microarray dataset, which comprises data from TNBC specimens and surrounding normal tissues, were obtained from the GEO database and normalized. Raw data were preprocessed (background correction using RMA algorithm, quantile normalization, and log2 transformation) using the limma package in R to ensure comparability across samples. DEGs were determined using “limma” in R (version 4.20) based on the following criteria: |log2 fold-change (FC)| ≥ 1.5 and false discovery rate (FDR) ≤0.05.[29,30] The expression levels were categorized as follows based on the log2 FC values: Upregulation, 0 and downregulation, <0. Volcano plots and heat maps were produced using ggplot2 and pheatmap packages, respectively.
Protein–protein interaction (PPI) networks and enrichment analyses
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed through the clusterProfiler package (Bioconductor 3.14, Sun Yat-sen University, Guangzhou, China) in R to characterize DEGs. GO functions encompass molecular function (MF), biological process (BP), and cellular component (CC). A PPI network was constructed utilizing the STRING database (https://string-db.org/).[31,32] The TSV-formatted dataset was loaded into Cytoscape platform for network visualization to generate graphical representations of messenger RNA (mRNA) regulatory relationships. Six candidate genes exhibiting the highest node connectivity in the PPI network were designated as central regulators for further investigation.
Hub gene association with survival
The associations between hub genes and survival were examined using Kaplan-Meier plotter. The mRNA profiles of BC specimens from the TCGA database were examined using GEPIA2 and UALCAN.
miRNA–mRNA network construction
TargetScan, miRDB, and miRWalk were used to predict potential miRNAs that can target TIGIT. The intersecting miRNAs were visualized using Venn diagrams generated with FunRich software (v3.13, http://www.funrich.org/). Cytoscape was used to develop regulatory networks for TIGIT and miRNAs.
Cells
Human BC cell lines MCF-7 [HTB-22], AU565 [CRL-2351], SKBR-3 [HTB-30], and MDA-MB-468/231 [HTB-132/26 cells] as well as MCF-10A [CRL-10317] epithelial cells were sourced from the American Type Culture Collection (Manassas, VA, USA). HEK293T (GNHu17) cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were identified using short tandem repeat profiling. Mycoplasma test was performed to ensure the quality of cell culture and the reliability of the experimental results. BC and HEK293T cell lines were routinely maintained in Dulbecco’s Modified Eagle Medium (DMEM) (SH30243.02, HyClone, Utah, USA) containing 10% fetal bovine serum (FBS) at 37℃ and 5% carbon dioxide. MCF-10A cells were propagated using DMEM/F12 (CM-0525, Gibco, Carlsbad, CA, USA) supplemented with 5% horse serum, thymidine, putrescine, zinc, and hypoxanthine.
RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR)
TRIzol (12183555, Invitrogen, California, USA) was employed for mRNA isolation from cells, while AxyPrep miRNA isolation kit (R401-01, Vazyme, Nanjing, China) was utilized to isolate miRNA. The isolated RNA was reverse transcribed into complementary DNA (cDNA) using HiScript III RT SuperMix for qPCR (+ gDNA wiper) and miRNA 1st strand cDNA synthesis kit (by stem-loop) (D7168M, Beyotime, Shanghai, China). qRT-PCR analysis was performed using BeyoFast™ SYBR Green qPCR Mix (D7260, Beyotime, Shanghai, China). The reactions were configured as follows: Initial denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing/extension at 60°C for 30 s. Relative expression levels of mRNA and miRNA were analyzed quantitatively through the 2−ΔΔCt method, with GAPDH and RNU6-1 as endogenous reference genes for normalization of mRNA and miRNA, respectively. The primer sequences are detailed in Table 1.
| Name | Sequence (5' → 3') | Usage |
|---|---|---|
| TIGIT F | GGAATGATGACAGGCACAATAGA | qRT-PCR |
| TIGIT R | CCATCAGGGTAGGTGTGATAGA | qRT-PCR |
| GAPDH F | ACCACAGTCCATGCCATCAC | qRT-PCR |
| GAPDH R | TCCACCACCCTGTTGCTGTA | qRT-PCR |
| U6 F | CTCGCTTCGGCAGCACATAT | qRT-PCR |
| U6 R | AACGCTTCACGAATTTGCGT | qRT-PCR |
| miR-15a-5p F | GCCGAGCACAAACC | qRT-PCR |
| miR-15a-5p R | CTCAACTGGTGTCGTGGA | qRT-PCR |
| miR-15a-5p RT | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCACAAACC | qRT-PCR |
| TIGIT3'UTR wt F | GATGGGGTTAGTTTAAATCAAGATGTGCTGTTA TAATTGGTATAAGCATAA |
Dual-Luciferase Reporter Assay |
| TIGIT3'UTR wt R | GATTTTATGCTTATACCAATTA TAACAGCACATCTTGATTTAAACTAACCCCATCTTAA |
Dual-Luciferase Reporter Assay |
| TIGIT3'UTR mut F | GATGGGGTTAGTTTAAATCAAGGCACATCATTA TAATTGGTATAAGCATAA |
Dual-Luciferase Reporter Assay |
| TIGIT3'UTR mut R | GATTTTATGCTTATACCAATTA TAATGATGTGCCTTGATTTAAACTAACCCCATCTTAA |
Dual-Luciferase Reporter Assay |
| miR-15a-5p mimics |
UAGCAGCACAUAAUGGUUUGUG | overexpression |
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
Cell transfection
Lentiviruses were procured from Genechem Co., Ltd. (Genechem, Shanghai, China) for the development of stably transfected cell lines. MDA-MB-231/468 cells in logarithmic growth were inoculated in six-well plates and transfected following the lentivirus transfection protocol. The multiplicity of infection (MOI) was set at 10. Stably expressing TIGIT cell populations were established through antibiotic selection with 2 μg/mL puromycin. At 72 h post-transfection, green fluorescent protein expression was analyzed under a laser confocal microscope (LSM 900, ZEISS, Oberkochen, Germany). Cells exhibiting strong fluorescence signals and stable growth were cultured for subsequent experiments. miR-15a-5p mimics and negative controls (NCs) were procured from Shanghai GenePharma Co., Ltd. (Genechem, Shanghai, China). MDA-MB-231/468 cells were transferred to six-well plates 1 day before transfection, cultured until 80% confluency, and transfected using Lipofectamine 3000 (L3000150, Invitrogen, California, USA). Transiently transfected cell lines were then constructed. Subsequent experiments were performed at designated time points.
Dual-luciferase reporter (DLR) assay
The BiBiServ database was employed to preliminarily estimate the potential docking location between miR-15a-5p and TIGIT. GenePharma generated TIGIT wild-type (WT) and mutant (Mut) constructs, along with miR-15a-5p mimics. The TIGIT-WT and TIGIT-Mut sequences were then cloned into the pmirGLO vector. The resulting pmirGLO-TIGIT-WT and pmirGLO-TIGIT-Mut constructs were transfected into HEK293T (GNHu17, Shanghai, China) cell lines together with miR-15a-5p mimics and miR-15a-5p NC using Lipofectamine 3000 (L3000150, Invitrogen, California, USA). Luciferase (luc) activity was measured 48 h post-transfection by utilizing a DLR assay system (Vazyme, Nanjing, China), with Renilla luc as the normalization control for firefly luc activity.
Western blotting (WB) assay
Following 48 h of exposure, cellular proteins were obtained from all cohorts through extraction with radioimmunoprecipitation assay (RIPA) lysis buffer comprising protease inhibitors, and their levels were measured (BCA Protein Assay Kit, P0011, Beyotime, Shanghai, China). The samples were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE). The resolved proteins were electroblotted onto a polyvinylidene fluoride membrane (E801-01, Vazyme, Nanjing, China). The membrane was incubated with 5% skim milk for blocking and probed with anti-TIGIT antibodies (rabbit, 1:2000, #99567, Cell Signaling Technology, USA) overnight at 4°C. Following three washes with Tris-buffered saline-Tween 20, the membrane was incubated with secondary antibodies (1:10000, #58802, Cell Signaling Technology, USA) for 1.5 h under ambient conditions. The membrane was washed three times, and protein bands were developed using Tanon 2500 (Bio-Rad, Shanghai, China) chemiluminescence imaging system. Protein expression levels were measured with ImageJ software (version 6.0; Media Cybernetics, Shanghai, China).
Cell counting kit-8 (CCK-8) assay
Transfected cells were inoculated in 96-well microplates. At designated intervals (0, 12, 24, 36, and 48 h post-transfection), the cellular samples were administered with CCK-8 detection kit (A311-01, Vazyme, Nanjing, China) and maintained for 1 h. The absorbance of the resultant solution was quantified at 450 nm using a multi-mode microplate reader (Bio-Tek, Vermont, USA).
Colony formation
Cellular suspensions (103 cells/well) were inoculated in six-well plates (CCP01096-B, Vazyme, Nanjing, China) and cultured for 24 h before transient transfection. After a 14-day culture period, the treated cells were immobilized with 4% paraformaldehyde (28908, Invitrogen, California, USA) for 30 min. After removing the fixative, samples were rinsed with phosphate buffer saline (PBS) 3 times and stained with 0.5% crystal violet (R40052, Invitrogen, California, USA) for 20 min. After rinsing, the samples were air-dried before imaging using a microscope (Smartzoom 5, ZEISS, Oberkochen, Germany). The images were analyzed using ImageJ software (version 6.0; Media Cybernetics, Shanghai, China).
Wound healing assay
After lentiviral transfection, 5 × 105 BC cells were seeded into each well of six-well plates. A standardized wound was generated in the cell monolayer using a sterile 200 μL pipette tip (PTR02014-01, Vazyme, Nanjing, China). The monolayer was immediately imaged. The culture medium was removed by aspiration, and adherent cells were flushed two to three times with PBS (G101, Vazyme, Nanjing, China) to remove dislodged cellular debris. The scratch width at identical positions was documented after 24 h of cultivation. The rate of scratch closure was evaluated.
Transwell invasion assay
Matrigel (A1569601, Invitrogen, California, USA) in combination with serum-free medium was uniformly coated onto the base of the transwell chamber (140627, Invitrogen, California, USA). The transfected BC cells were resuspended in serum-free medium, and 150 μL of cell suspension was loaded into the upper compartment. The lower chamber was filled with 700 μL of culture medium supplemented with 10% FBS (A5670701, Invitrogen, California, USA). After 24 h of culture, the transwell chamber was detached. The Matrigel, along with the cells within the chamber, was gently wiped using PBS-soaked cotton. Invaded cells adhering to the underside of the membrane were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet solution for 10 min. Images of three to five microscopic fields were captured. The cells were counted from the images using ImageJ software.
Flow cytometry
Cells were incubated for 24 h, transfected, subjected to trypsin digestion, and pooled. The samples were incubated in cooled PBS. The resulting cellular mixture was stabilized in cooled 70% ethanol and maintained at 4°C overnight. The cells were rinsed twice with PBS, treated with 100 μL of RNase A (#4087; Cell Signaling Technology, USA) at 37°C for 30 min, and incubated with 400 μL of propidium iodide (PI) for 30 min at 4°C. Cell cycle phase distribution and apoptotic proportions were evaluated using a flow cytometer (CytoFLEX S, Beckman Coulter Co., Ltd., California, USA).
Statistical analysis
Data were analyzed with R 4.1.0 (v4.1.0, R Foundation for Statistical Computing, Vienna, Austria) and GraphPad Prism 9.0 (v9.0, San Diego, CA, USA). Intergroup comparisons were conducted using unpaired t-tests for two-group analyses and one-way analysis of variance, followed by Tukey’s post hoc testing for multi-group comparisons. Numerical results are expressed as mean ± SD. A threshold of P < 0.05 was statistically significant. Each experiment was repeated three times to verify reproducibility.
RESULTS
Screening of DEGs
Gene expression data from the GSE22513 dataset were normalized and transformed into a log2 scale. The filtering parameters were as follows: FDR <0.05; log2 FC ≥ 1.5; log2 FC ≤ −1.5. This study identified 139 DEGs (37 upregulated and 102 downregulated genes), which were visualized as volcano plots [Figure 1a] and heatmaps [Figure 1b] using the R package. In the volcano plot, red dots signify upregulated genes, while green dots denote those that were downregulated.

- TIGIT levels are elevated in TNBC and modulated by miR-15a-5p based on bioinformatic analysis. (a) Differential gene expression visualization through volcano plotting, with upregulated and downregulated transcripts depicted in red and green, respectively. (b) Expression heatmap of DEGs in the GSE22513 dataset. (c-f) GO and KEGG functional enrichment analyses of DEGs. Scatter plots showing BP (c), CC (d), MF (e), and KEGG pathway (f) annotations. (g) Network analysis of core genes extracted from DEGs and PPI, with principal modules and essential genes identified through Cytoscape MCODE plugin. (h) Kaplan–Meier analysis revealed the correlation of TIGIT dysregulation with unfavorable outcomes in patients with BC. (i and j) Analysis of GEPIA2 and UALCAN datasets demonstrated that TIGIT expression in BC specimens, especially in luminal BC, HER2-positive BC, and TNBC, was upregulated when compared with that in normal tissue controls. (k) Venn diagram illustration of TIGIT-targeting microRNAs (miRNAs) predicted through integrated analysis of miRWalk, miRDB, and TargetScan databases. (l) Computational prediction of TIGIT-miR-15a-5p interaction site using BiBiServ. ns: No significant difference; ✶P <0.05. PPI: Protein-protein interaction, FDR: False discovery rate, KEGG: Kyoto Encyclopedia of Genes and Genomes, MF: Molecular function, BP: Biological process, TIGIT: T cell immunoreceptor with Ig and ITIM domains, CC: Cellular component, GO: Gene Ontology, TNBC: Triple-negative breast cancer, BC: Breast cancer, DEGs: Differentially expressed genes.
GO and KEGG analyses
The enrichment of DEGs in different GO terms was as follows: BP term: “negative Negative hydrolase activity modulation,” “negative peptidase activity modulation,” “digestion,” “negative small molecule metabolic pathway modulation,” and “digestive system process” [Figure 1c]; CC term: “Perinuclear region of cytoplasm,” “specific granule,” and “specific granule lumen” [Figure 1d]; and MF term: “Carbohydrate binding,” “dystroglycan binding,” and “aldoketo reductase NADP activity” [Figure 1e]. The DEGs were enriched in the following KEGG pathways: “Arachidonic acid metabolism,” “mineral absorption,” “long-term depression,” “salivary secretion,” and “glucagon signaling pathway” [Figure 1f].
Identification of hub genes in the PPI network
A PPI network was developed by importing 139 DEGs into the STRING database. The exported data were filtered to retain entries with a combined score of >0.4. This dataset was subsequently uploaded to Cytoscape software. The MCODE plugin was used to identify key modules for further investigation. The hub genes identified through this process included CCR6, ICOS, PRF1, TIGIT, GATA3, and IDO1 [Figure 1g].
Survival analysis
Survival analysis of the hub genes indicated that TIGIT levels were markedly linked to recurrence-free survival in individuals with BC (P < 0.05), [Figure 1h]. Analysis of the GEPIA2 dataset revealed that TIGIT expression in BC samples, including luminal BC, human epidermal growth factor receptor 2 (HER2)-positive BC, and basal-like BC (TNBC), was markedly higher than in non-cancerous samples [Figure 1i]. TIGIT exhibited a similar expression pattern in the UALCAN dataset [Figure 1j]. The analysis of GEPIA2 and UALCAN datasets revealed that TIGIT levels in TNBC were markedly upregulated when compared with those in luminal BC and HER2-positive BC.
miR-15a-5p directly targets and downregulates TIGIT
miRNAs targeting TIGIT were identified using miRDB, miRWalk, and TargetScan databases. Venn diagrams revealed that 41 common miRNAs identified from the three databases were potential direct regulators of TIGIT [Figure 1k]. The potential binding site between miR-15a-5p and TIGIT was determined through the BiBiServ online platform [ Figure 1l] to validate their explicit molecular linkage. The Pearson’s correlation analysis of the TCGA datasets revealed that TIGIT was negatively correlated with miR-15a-5p in different cancer types, especially in thymoma and bladder urothelial carcinoma [Figure S1]. qRT-PCR indicated that five BC cell lines exhibited marked upregulation of TIGIT expression and concurrent suppression of miR-15a-5p compared with their normal counterparts [Figure 2a and b]. The WB analysis demonstrated that TIGIT protein levels in BC cell lines were higher than in normal cells [Figure 2c and d]. Subsequent DLR experiments suggested that introducing miR-15a-5p mimics to HEK293T cells substantially decreased the luc signal of the pmirGLO-TIGIT-WT plasmid versus the miR-15a-5p NC cohort. By contrast, the luc signals of the pmirGLO-TIGIT-MUT plasmid were unchanged [Figure 2e and f], providing evidence that miR-15a-5p directly interacts with TIGIT. For further experiments, MDAMB-468 and MDA-MB-231 cells were selected. Fluorescence microscopy analysis demonstrated that lentivirus infection efficiency varied at different MOI values (MOI = 2, 10, or 50). At an MOI of 10, the infection efficiency was higher than 80% [Figure 2g]. These findings indicate that the lentivirus infection efficiency was sufficient for further analyses.

- Validation of TIGIT as the target gene of miR-15a-5p and analysis of its expression. (a and b) Quantitative assessment of miR-15a-5p and TIGIT contents between different BC cells and normal breast epithelial cells by utilizing qRT-PCR methodology. (c and d) TIGIT protein abundance in different BC cells was evaluated through WB analysis. (e and f) Direct interaction between miR-15a-5p and TIGIT was validated using the DLR assay. (g) Green fluorescent protein expression patterns in cells transfected with lentiviral constructs at different MOI levels were examined using laser confocal microscopy (Scale bar = 50 μm) (h-k). Effects of transfection with LV-vector, LV-TIGIT, miR-15a-5p mimics, NC, or their combinations in BC cells on the expression profiles were assessed using qRT-PCR (h-k) and WB analyses (l and m). Values are expressed as mean ± SD from three distinct experimental replicates. ns: No significant difference, ✶P <0.05, ✶✶P < 0.01, ✶✶✶P <0.001, and ✶✶✶✶P <0.0001 compared with the NC-transfected cells. qRT-PCR: Quantitative real-time polymerase chain reaction, LV: Lentivirus vector, NC: Negative control, MOI: Multiplicity of infection, WB: Western blotting, SD: Standard deviation, BC: Breast cancer.
qRT-PCR analysis revealed that the miR-15a-5p levels were upregulated, and the TIGIT levels were downregulated in miR-15a-5p mimic-transfected cells compared with those in NC-transfected cells. Moreover, TIGIT expression was upregulated, and miR-15a-5p expression was downregulated in LV-TIGIT-transfected cells compared with those in LV-vector-transfected cells. Meanwhile, TIGIT expression was downregulated, and miR-15a-5p expression was upregulated in cells co-transfected with miR-15a-5p mimics and LVTIGIT compared with those in LV-TIGIT-transfected cells [Figure 2h-k]. The WB analysis confirmed the findings of qRT-PCR analysis [Figure 2l and m]. These observations suggest that elevated miR-15a-5p levels potentially downregulate TIGIT gene expression. Hence, miR-15a-5p might function as a direct regulator of the TIGIT level.
miR-15a-5p mitigates TIGIT-induced upregulation of TNBC cell growth, migration, and invasion by modulating cell cycle and inducing apoptosis
The viability of transfected TNBC lines (MDA-MB-231/468) was evaluated at multiple time points (0, 12, 36, and 48 h) using the CCK-8 assay. Compared with NC-transfected cells, miR-15a-5p mimic-transfected cells exhibited decreased viability. Conversely, LV-TIGIT-transfected cells exhibited enhanced viability when compared with LV-vector-transfected cells. Notably, the miR-15a-5p mimics and LV-TIGIT cotransfection reduced cell proliferation compared with that in the LV-TIGIT cohort [Figure 3a and b]. The proliferative potential of transfected TNBC cells was examined using colony formation assay. Cells containing miR-15a-5p mimics showed markedly diminished colony development compared with NC controls. By contrast, TIGIT overexpression enhanced colony formation relative to the LV-vector cohort. Nevertheless, the miR-15a-5p mimics and LV-TIGIT co-incorporation diminished colony formation ability versus the LV-TIGIT cohort [Figure 3c-f]. The migration of TNBC cells, shown by wound-healing assessments, was diminished after miR-15a-5p mimic-transfection versus the NC-transfected. Conversely, the migration of LV-TIGIT-transfected cells was higher than that of LV-vector-transfected cells. Furthermore, the miR-15a-5p mimics and LV-TIGIT co-incorporation decreased migration ability compared with that in the LVTIGIT cohort [Figure 4a-d]. Transwell assay was performed to examine the invasive potential of transfected cells. The incorporation of the miR-15a-5p mimic diminished the TNBC cell quantity traversing the basement membrane in comparison with that in the NC cohort. The elevated TIGIT expression increased the number of invasive cells compared with that in the LV-vector cohort. Furthermore, the miR-15a-5p mimics and LV-TIGIT co-incorporation reduced invasion when compared with the LV-TIGIT cohort [Figure 4e-h]. The impact of transfection on TNBC cell cycle progression and apoptotic rates was assessed by flow cytometry. Cell cycle profiling indicated that cells transfected with miR-15a-5p mimics displayed G2/M phase arrest relative to the NC-transfected group. By contrast, TIGIT overexpression reduced the duration of the G2/M phase compared with that in the LV-vector group. Notably, co-transfection with miR-15a-5p mimics and LV-TIGIT resulted in elevated G2/M phase accumulation [Figure 5a-d]. The apoptosis rate (Annexin V+/PI+) in miR-15a-5p mimic-transfected cells was markedly higher than that in NC-transfected cells, whereas the apoptosis rate in LV-TIGIT-transfected cells was lower than that in LV-vector-transfected cells. Furthermore, the apoptosis rate in cells co-transfected with miR-15a-5p mimics and LV-TIGIT was significantly higher than that in cells transfected with LV-TIGIT [Figure 5e-h]. These observations suggest that miR-15a-5p overexpression may inhibit or even counteract the effects of TIGIT in promoting TNBC growth, migration, and invasiveness while triggering cell cycle arrest and enhancing apoptosis.

- Effect of miR-15a-5p and TIGIT on TNBC cell proliferation and clone formation ability. (a and b) Effect of transfection with LV-vector, LV-TIGIT, miR-15a-5p mimics, NC, or both on MDA-MB-231/468 cell proliferation was systematically evaluated using CCK-8 proliferation analysis. (c-f) Effect of transfection with LV-vector, LV-TIGIT, miR-15a-5p mimics, NC, or both on the clone formation ability of MDA-MB-231 (c and e) and MDA-MB-468 (d and f) cells was evaluated using the colony formation assay. Values are expressed as mean ± SD from three distinct experiments. ✶✶✶✶P <0.0001 compared with the NC-transfected group. TNBC: Triple-negative breast cancer, LV: Lentivirus vector, CCK-8: Cell counting kit-8, NC: Negative control, SD: Standard deviation.

- Impacts of miR-15a-5p and TIGIT on TNBC cell migration and invasion. (a-d) Cell migration, as evidenced by wound healing assessment (Scale bar = 500 μm), following the incorporation of LV-vector, LV-TIGIT, miR-15a-5p mimics, NC, or both into MDA-MB-231 (a and b) and MDA-MB-468 (c and d) cells. (e-h) Effect of transfection with LV-vector, LV-TIGIT, miR-15a-5p mimics, NC, or both on the invasive ability of MDA-MB-231 (e and f) and MDA-MB-468 (g and h) cells was evaluated using the transwell assay (Scale bar = 200 μm). Values are represented as mean ± SD from three distinct experiments. ✶✶✶✶P <0.0001 compared with the NC-transfected group. SD: Standard deviation, NC: Negative control, LV: Lentivirus vector, TNBC: Triple-negative breast cancer.

- Impacts of miR-15a-5p and TIGIT on TNBC cell cycle and apoptosis. (a-d) Effect of transfection with LV-vector, LV-TIGIT, miR-15a-5p mimics, NC, or both on the cell cycle of MDA-MB-231 (a and c) and MDA-MB-468 (b and d) cells was examined using flow cytometry. (e-h) Effect of transfection with LV-vector, LV-TIGIT, miR-15a-5p mimics, NC, or both on the apoptosis of MDA-MB-231 (e and g) and MDA-MB-468 (f and h) cells was examined using flow cytometry. Values are represented as mean ± SD from three distinct experiments. ✶✶✶P <0.001, ✶✶✶✶P <0.0001 compared with the NC-transfected cells. NC: Negative control, LV: Lentivirus vector, SD: Standard deviation.
DISCUSSION
The incidence of BC, which is the most prevalent malignant tumor affecting women, increases each year. It currently ranks as one of the predominant cancers worldwide.[1] Among different types of BC, TNBC is associated with increased recurrence rates and unfavorable outcomes. Thus, efforts are ongoing to discover novel biomarkers for diagnosing TNBC and monitoring its treatment response. In this study, bioinformatic analysis revealed that TIGIT was associated with unfavorable outcomes in BC.
TIGIT acts as an immune checkpoint molecule and facilitates immune evasion by inhibiting the functionality of cytotoxic T cell and NK cell through interaction with CD155/CD112 expressed on antigen-presenting cells. TNBC exhibits an immunosuppressive tumor microenvironment (TME), which is marked by the accumulation of regulatory T cells and dysfunctional CD8+ T cells. Thus, TIGIT overexpression in TNBC may suppress antitumor immunity.[22] The downregulation of miR-15a-5p in TNBC could exacerbate this process, as emerging evidence suggests its role in modulating T-cell exhaustion markers, such as PD-1.[33] Thus, the miR-15a-5p/TIGIT axis regulates cancer cells and immune cells in the TME. Data analyzed using the GEPIA2 and UALCAN databases revealed that TIGIT expression was markedly elevated in BC, particularly in TNBC, compared with that in normal tissues. The qRT-PCR analysis of BC and non-cancerous cells confirmed that TIGIT levels were upregulated in BC cell lines, thereby confirming previous experimental observations. Moreover, the WB results were consistent with the qRT-PCR findings.
The dysregulated expression of genes caused by miRNAs is frequently seen in tumors.[34] Among these, miR-15a-5p predominantly suppresses tumorigenesis.[35,36] Reduced miR-15a-5p levels are linked to unfavorable prognoses across diverse cancer types. In the present study, miR-15a-5p levels in BC cells were downregulated when compared with those in normal breast epithelial cells, consistent with previous research findings that miR-15a-5p is lowly expressed in BC.[17] miR-15a-5p suppresses cell proliferation by regulating the expression of specific targets.[37,38] The present study revealed that miR-15a-5p functions as a post-transcriptional regulatory factor and exerts direct regulatory effects on TIGIT. Analysis using the BiBiServ database indicated that miR-15a-5p may potentially interact with the base binding site of TIGIT. This study is the first to establish the modulatory link between miR-15a-5p and TIGIT. The DLR assay results confirmed the direct interaction between TIGIT and miR-15a-5p. In addition, miR-15a-5p downregulated the TIGIT level. LV-vector, LV-TIGIT, miR-15a-5p mimics NC, and miR-15a-5p mimics were transferred into MDA-MB-231 and MDA-MB-468 cells to evaluate the miR-15a-5p- and TIGIT-mediated roles in TNBC.
Fluorescence microscopy, qRT-PCR, and WB were utilized to assess miR-15a-5p and TIGIT levels after transfection. TNBC cells, in which high transfection efficiency was achieved, were subjected to functional experiments. He et al.[25] reported that TIGIT levels were markedly associated with cell metabolism in gastric cancer, and they influenced cell proliferation, cytokine production, and migratory capacity. Chen et al.[39] demonstrated that TIGIT downregulation inhibits tumor growth in murine models. Moreover, elevated miR-15a-5p expression suppresses the target gene BMI1, leading to increased doxorubicin sensitivity of BC cells and enhanced chemotherapeutic outcomes in patients with doxorubicin-resistant BC.[40] Compared with NC-transfected BC cells, miR-15a-5p mimic-transfected BC cells exhibited decreased proliferative, migratory, and invasive capabilities. When cells underwent lentiviral particle transfection, they exhibited enhanced proliferative, migratory, and invasive properties in comparison with the LV-vector cohort. The simultaneous introduction of miR-15a-5p mimics and LVTIGIT resulted in diminished cell growth, migration, and invasiveness compared with that in the LV-TIGIT cohort alone. These observations indicate that miR-15a-5p inhibits tumorigenesis by attenuating the malignant characteristics of TNBC through TIGIT regulation.
miR-15a-5p modulates cellular division processes by acting on genetic loci responsible for producing CDK1, 2, and 6 as well as regulating the expression of cyclins E1, D1, and D3.[41] Transfection with miR-15a-5p mimics induced cell cycle arrest in mammary carcinoma populations during the G2/M transition period. By contrast, transfection with LV-TIGIT decreased the duration of cells in the G2/M transition period. The introduction of the combined miR-15a-5p mimics and LV-TIGIT promoted G2/M phase arrest in TNBC cells. Annexin V/PI iodide dual staining indicated that the exogenous delivery of miR-15a-5p mimics potentiated programmed cell death processes. Meanwhile, transfection with LV-TIGIT suppressed apoptosis. Furthermore, co-transfection of LV-TIGIT and miR-15a-5p mimics upregulated apoptosis in TNBC cells. These observations imply that elevated miR-15a-5p expression coupled with reduced TIGIT expression induces cell cycle arrest at the G2/M phase, thereby stimulating programmed cell death. This preliminary study discovered the modulatory connection between miR-15a-5p and TIGIT. However, the findings must be validated in animal models. Additional potential pathways and upstream or downstream molecules must be elucidated, considering that tumor signaling networks are intricate. Future studies should focus on the miR-15a-5p/TIGIT axis in the TNBC immune microenvironment. Moreover, elucidating the synergistic mechanisms of combined immunotherapy and developing novel targeted therapeutics based on this axis may pave the way for substantial advancements in TNBC clinical treatment to enhance patient outcomes.
SUMMARY
Among the BC-related DEGs identified in this study using bioinformatic analysis, TIGIT expression was markedly upregulated and strongly linked to the prognosis of patients with BC. Upstream miRNAs associated with differentially expressed TIGIT were predicted. miR-15a-5p was demonstrated to directly suppress TIGIT expression in TNBC cells. The modulatory association between miR-15a-5p and TIGIT was experimentally validated. This study demonstrated that miR-15a-5p functions as a tumor suppressor by downregulating TIGIT and inhibiting the malignant phenotype of TNBC. Thus, miR-15a-5p and TIGIT are proposed as promising biomarkers and therapeutic targets for TNBC.
AVAILABILITY OF DATA AND MATERIALS
The BC dataset in this study was downloaded from the GEO database.
ABBREVIATIONS
BC: Breast cancer
BP: Biological process
CC: Cellular component
CCK8: Cell counting kit-8
DEGs: Differentially expressed genes
FDR: False discovery rate
GO: Gene Ontology
KEGG: Kyoto Encyclopedia of Genes and Genomes
LV: Lentivirus vector
MF: Molecular function
miRNAs: microRNAs
MOI: Multiplicity of Infection
NC: Negative control
PPI: Protein–protein interaction
qRT-PCR: Quantitative real-time polymerase chain reaction
SD: Standard deviation
TCGA: The Cancer Genome Atlas
TIGIT: T-cell immunoreceptor with Ig and ITIM domains
TNBC: Triple-negative breast cancer
WB: Western blotting
AUTHOR CONTRIBUTIONS
LMW: Conception and design; SPF and JTC: Data acquisition and analysis; SPF: Writing original draft; YJS: Writing review and editing; SPF and ZHW: Data visualization; LMW: Supervision. The authors read and approved the final manuscript. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
Ethical approval and consent to participate were not required as this study did not involve animal or human experimentation, and the patient data used were obtained from the database.
CONFLICTS OF INTEREST
The authors declare no conflict of interests.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Not applicable.
References
- Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74:229-63.
- [CrossRef] [PubMed] [Google Scholar]
- Triple-negative breast cancer risk genes identified by multigene hereditary cancer panel testing. J Natl Cancer Inst. 2018;110:855-62.
- [CrossRef] [PubMed] [Google Scholar]
- Characterizing the efficacy and safety of chemotherapy plus everolimus in HER2-negative metastatic breast cancer harboring altered PI3K/AKT/mTOR. Discov Med. 2024;36:527-37.
- [CrossRef] [PubMed] [Google Scholar]
- Anti-TGF-β/PD-L1 bispecific antibody promotes T cell infiltration and exhibits enhanced antitumor activity in triple-negative breast cancer. J Immunother Cancer. 2022;10:e005543.
- [CrossRef] [PubMed] [Google Scholar]
- MicroRNAs: Small RNAs with a big role in gene regulation. Nat Rev Genet. 2004;5:522-31.
- [CrossRef] [PubMed] [Google Scholar]
- MicroRNA therapeutics: Towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov. 2017;16:203-22.
- [CrossRef] [PubMed] [Google Scholar]
- Control of metastatic progression by microRNA regulatory networks. Nat Cell Biol. 2013;15:546-54.
- [CrossRef] [PubMed] [Google Scholar]
- Microfluidics for detection of exosomes and microRNAs in cancer: State of the art. Mol Ther Nucleic Acids. 2022;28:758-91.
- [CrossRef] [PubMed] [Google Scholar]
- Triple-negative breast cancer: Promising prognostic biomarkers currently in development. Expert Rev Anticancer Ther. 2021;21:135-48.
- [CrossRef] [PubMed] [Google Scholar]
- Noncoding RNA therapeutics-challenges and potential solutions. Nat Rev Drug Discov. 2021;20:629-51.
- [CrossRef] [PubMed] [Google Scholar]
- The microRNA-15a-PAI-2 axis in cholangiocarcinoma-associated fibroblasts promotes migration of cancer cells. Mol Cancer. 2018;17:10.
- [CrossRef] [PubMed] [Google Scholar]
- p53-induced miR-15a/16-1 and AP4 form a double-negative feedback loop to regulate epithelial-mesenchymal transition and metastasis in colorectal cancer. Cancer Res. 2014;74:532-42.
- [CrossRef] [PubMed] [Google Scholar]
- miR-34a and miR-15a/16 are co-regulated in non-small cell lung cancer and control cell cycle progression in a synergistic and Rb-dependent manner. Mol Cancer. 2011;10:55.
- [CrossRef] [PubMed] [Google Scholar]
- E2F7 overexpression leads to tamoxifen resistance in breast cancer cells by competing with E2F1 at miR-15a/16 promoter. Oncotarget. 2015;6:31944-57.
- [CrossRef] [PubMed] [Google Scholar]
- Upregulation of SNHG12 accelerates cell proliferation, migration, invasion and restrain cell apoptosis in breast cancer by enhancing regulating SALL4 expression via sponging miR-15a-5p. Neoplasma. 2020;67:861-70.
- [CrossRef] [PubMed] [Google Scholar]
- Microribonucleic acid-15a-5p alters adriamycin resistance in breast cancer cells by targeting cell division cycle-associated protein 4. Cancer Manag Res. 2021;13:8425-34.
- [CrossRef] [PubMed] [Google Scholar]
- Procaine induces epigenetic changes in HCT116 colon cancer cells. Genet Res Int. 2016;2016:8348450.
- [CrossRef] [PubMed] [Google Scholar]
- Genomic evolution of breast cancer metastasis and relapse. Cancer Cell. 2017;32:169-184.e7.
- [CrossRef] [PubMed] [Google Scholar]
- The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. Nat Immunol. 2009;10:48-57.
- [CrossRef] [PubMed] [Google Scholar]
- Use of aspirin in the prevention of colorectal cancer through TIGITCD155 pathway. J Cell Mol Med. 2019;23:4514-22.
- [CrossRef] [PubMed] [Google Scholar]
- The immune checkpoint TIGIT/CD155 promotes the exhaustion of CD8 + T cells in TNBC through glucose metabolic reprogramming mediated by PI3K/AKT/mTOR signaling. Cell Commun Signal. 2024;22:35.
- [CrossRef] [PubMed] [Google Scholar]
- Expression of lymphocyte-activating gene 3 and T-cell immunoreceptor with immunoglobulin and ITIM domains in cutaneous melanoma and their correlation with programmed cell death 1 expression in tumor-infiltrating lymphocytes. J Am Acad Dermatol. 2019;81:219-27.
- [CrossRef] [PubMed] [Google Scholar]
- Prognostic value of the tumor immune microenvironment for early-stage, non-small cell lung cancer. Am J Clin Oncol. 2021;44:350-5.
- [CrossRef] [PubMed] [Google Scholar]
- CD155T/TIGIT signaling regulates CD8(+) T-cell metabolism and promotes tumor progression in human gastric cancer. Cancer Res. 2017;77:6375-88.
- [CrossRef] [PubMed] [Google Scholar]
- T-Cell immunoglobulin and ITIM domain (TIGIT) associates with CD8+ T-cell exhaustion and poor clinical outcome in AML patients. Clin Cancer Res. 2016;22:3057-66.
- [CrossRef] [PubMed] [Google Scholar]
- TIGIT immune checkpoint blockade restores CD8(+) T-cell immunity against multiple myeloma. Blood. 2018;132:1689-94.
- [CrossRef] [PubMed] [Google Scholar]
- The immunoreceptor TIGIT regulates antitumor and antiviral CD8(+) T cell effector function. Cancer Cell. 2014;26:923-37.
- [CrossRef] [PubMed] [Google Scholar]
- limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43:e47.
- [CrossRef] [PubMed] [Google Scholar]
- FN1, SPARC, and SERPINE1 are highly expressed and significantly related to a poor prognosis of gastric adenocarcinoma revealed by microarray and bioinformatics. Sci Rep. 2019;9:7827.
- [CrossRef] [PubMed] [Google Scholar]
- STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019;47:D607-13.
- [CrossRef] [PubMed] [Google Scholar]
- Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13:2498-504.
- [CrossRef] [PubMed] [Google Scholar]
- miR-15a and miR-15b modulate natural killer and CD8(+)T-cell activation and anti-tumor immune response by targeting PD-L1 in neuroblastoma. Mol Ther Oncolytics. 2022;25:308-29.
- [CrossRef] [PubMed] [Google Scholar]
- OncomiRs: The discovery and progress of microRNAs in cancers. Mol Cancer. 2007;6:60.
- [CrossRef] [Google Scholar]
- miRNA-15a/16: As tumor suppressors and more. Future Oncol. 2015;11:2351-63.
- [CrossRef] [PubMed] [Google Scholar]
- The miR-15a/16 gene cluster in human cancer: A systematic review. J Cell Physiol. 2019;234:5496-506.
- [CrossRef] [PubMed] [Google Scholar]
- MiR-15a is underexpressed and inhibits the cell cycle by targeting CCNE1 in breast cancer. Int J Oncol. 2013;43:1212-8.
- [CrossRef] [PubMed] [Google Scholar]
- Histone deacetylases inhibitor trichostatin A increases the expression of Dleu2/miR-15a/16-1 via HDAC3 in non-small cell lung cancer. Mol Cell Biochem. 2013;383:137-48.
- [CrossRef] [PubMed] [Google Scholar]
- TIGIT(+) CD4(+) regulatory T cells enhance PD-1 expression on CD8(+) T cells and promote tumor growth in a murine ovarian cancer model. J Ovarian Res. 2024;17:252.
- [CrossRef] [PubMed] [Google Scholar]
- miR-15a/miR-16 down-regulates BMI1, impacting Ub-H2A mediated DNA repair and breast cancer cell sensitivity to doxorubicin. Sci Rep. 2017;7:4263.
- [CrossRef] [PubMed] [Google Scholar]
- MicroRNAs and the cell cycle. Biochim Biophys Acta. 2011;1812:592-601.
- [CrossRef] [PubMed] [Google Scholar]
