Translate this page into:
Novel mechanism of tumor metastasis: DDX11–ATAD5 interaction mediates epithelial–mesenchymal transition to promote gallbladder cancer progression

Weishu Kong

Huali Yang
*Corresponding author: Weishu Kong, Jining Medical University, Jining City, Shandong, China xzbmf888@163.com
Huali Yang, Department of Ultrasonography, Ruijin Hospital, School of Medicine, Shanghai Jiaotong University, Shanghai, China. kws23501@sohu.com
-
Received: ,
Accepted: ,
How to cite this article: Kong L, Li W, Kong W, Yang H. Novel mechanism of tumor metastasis: DDX11–ATAD5 interaction mediates epithelial– mesenchymal transition to promote gallbladder cancer progression. CytoJournal. 2025;22:102. doi: 10.25259/Cytojournal_42_2025
Abstract
Objective:
Molecular mechanisms underlying gallbladder cancer (GBC) progression remain incompletely understood. This study aims to investigate the role and molecular mechanism of DEAD/H-box helicase 11 (DDX11)–ATPase family AAA domain containing 5 (ATAD5) protein interaction in GBC pathogenesis.
Material and Methods:
Cell proliferation, colony formation, and Transwell assays were performed to evaluate the effects of DDX11–ATAD5 interaction in GBC cells. Sequencing data were analyzed to assess DDX11 and ATAD5 expression in GBC tissues, and immunofluorescence co-localization and co-immunoprecipitation assays were conducted to verify the interaction between DDX11 and ATAD5. Subcutaneous xenograft and metastasis models were established to validate their functions in vivo, and E-cadherin and vimentin were detected by quantitative real-time polymerase chain reaction.
Results:
Both DDX11 and ATAD5 were upregulated in GBC tissues and exhibited direct protein–protein interaction (P < 0.05). Functional studies revealed that DDX11 promoted GBC cell proliferation, migration, and invasion while inhibiting apoptosis (P < 0.01). ATAD5 silencing markedly attenuated the oncogenic effects mediated by DDX11. In vivo experiments further confirmed that DDX11 overexpression enhanced subcutaneous tumor growth and metastasis in nude mice (P < 0.001). Mechanistically, the DDX11–ATAD5 complex promoted GBC cell invasion and metastasis by facilitating the epithelial-mesenchymal transition (EMT; P < 0.01).
Conclusion:
This study reveals a novel molecular mechanism whereby DDX11–ATAD5 interaction promotes GBC progression through EMT activation, providing potential therapeutic targets for GBC diagnosis and treatment.
Keywords
ATPase family AAA domain containing 5
DEAD/H-box helicase 11
Epithelial-mesenchymal transition
metastasis
Gallbladder cancer
INTRODUCTION
Gallbladder cancer (GBC) is characterized by high invasiveness, metastatic potential, and poor prognosis,[1] and its incidence shows substantial geographical and ethnic variations worldwide. Due to its insidious onset and challenges associated with its early diagnosis, most patients are diagnosed at advanced stages, with a dismal 5-year survival rate of approximately 5%.[2,3] Although surgical resection remains the most effective treatment option, most patients are ineligible for surgery due to local invasion and distant metastasis.[4-6]
Recent advances in molecular biology have revealed the crucial roles of ribonucleic acid (RNA) helicases in tumor development and progression.[7,8] DEAD/H-box helicase 11 (DDX11), which is an ATP-dependent deoxyribonucleic acid (DNA) helicase, plays essential roles in DNA replication, chromosome segregation, and genome stability maintenance.[9,10] Accumulating evidence suggests that DDX11 is aberrantly expressed in various types of cancer and closely associated with tumor progression.[11,12] For instance, high DDX11 expression correlates with enhanced proliferation and metastasis in lung cancer,[12] while in liver cancer, DDX11 promotes tumor cell proliferation by regulating the cell cycle.[13] However, the expression pattern and functional mechanisms of DDX11 in GBC remain unclear. In addition, the ATPase family AAA domain containing 5 (ATAD5), which is a crucial DNA replication regulator, participates in DNA damage repair and genome stability maintenance.[14] Recent studies have highlighted the essential role of ATAD5 in various types of cancer,[15-18] but its role in GBC and potential interaction with DDX11 remain unexplored.
Epithelial-mesenchymal transition (EMT) is a crucial event in tumor metastasis, thereby enhancing tumor cell migration and invasion capabilities.[19-21] Extensive research has demonstrated the critical role of EMT in GBC progression,[22] but the molecular mechanisms regulating EMT are not fully understood, particularly those involved in protein-protein interaction (PPI) networks in EMT regulation.[23,24] At present, whether DDX11–ATAD5 protein interaction participates in GBC EMT regulation and its specific molecular mechanisms remain unclear.
Given these research gaps, this study aims to investigate the role and molecular mechanisms of DDX11– ATAD5 protein interaction in GBC pathogenesis. We comprehensively examined the effects of DDX11–ATAD5 interactions on GBC cell proliferation, migration, and invasion capabilities in vitro and in vivo, and explored its relationship with EMT. This study provides new insights into the molecular mechanisms of GBC development and potentially identifies novel molecular targets for therapeutic intervention.
MATERIAL AND METHODS
Bioinformatic analysis
The transcriptomic datasets of GBC and paired adjacent normal tissues (GSE202479 and GSE139682) were obtained from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/gds). The logarithmic transformation of the data matrix was performed after correction and normalization. Using R software (version 4.1.0) and the edgeR package, differential gene expression analysis was carried out using the selection criteria of |log2FC| > 1 and adjusted P-value < 0.05. Hierarchical clustering analysis was employed to construct heatmaps and volcano plots of differentially expressed genes. With P < 0.05 as the enrichment threshold, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed to investigate the biological roles of differentially expressed genes.
Protein-protein interaction network prediction
DDX11 PPI network analysis was performed using the STRING database (https://string-db.org/) to analyze DDX11-interacting proteins and construct the PPI network.
Cell culture
Human GBC cells (GBC-SD [BFN60800654], NOZ(STMCL-5283; Cell Bank of the Chinese Academy of Sciences) were cultured in Dulbecco’s modified eagle medium (DMEM) high-glucose medium (41401ES, Yeasen, Shanghai, China) supplemented with 10% fetal bovine serum (S9000, Solarbio, Beijing, China) and 1% penicillin-streptomycin (P1400, Solarbio, Beijing, China) at 37°C with 5% carbon dioxide (CO2). Cell morphology and growth status were monitored daily using an inverted microscope (CKX53, Olympus Corporation, Tokyo, Japan), and cells in logarithmic growth phase were used for experiments. All cell lines were authenticated by short tandem repeat (STR) profiling and tested negative for mycoplasma contamination. For DDX11 overexpression vector construction (the sequence of DDX11 overexpression vector was presented in the supplementary section), the DDX11 gene CDS sequence was obtained from NCBI database and PCR-amplified using GBC-SD cell cDNA as template with high-fidelity polymerase. Homologous recombination primers were designed using CE Design software (v1.04, Vazyme, Nanjing, China) and Snapgene 4.3.6 (GSL Biotech LLC, Boston, MA, USA) to clone the target gene into a pCDH vector (GeneCopoeia, Rockville, MD, USA). The DDX11 targeting sequences for shRNA interference were obtained using Sigma’s online design tool, and shDDX11 expression vectors were constructed following Addgene’s pLKO.1 vector cloning strategy. After lentivirus transfection, stable transfection cell lines were screened using G418:
sh-NC (negative control to DDX11 shRNA: 5'-CCGGA GGTTACGTTTTTTTTTCTTTCTCGAGAAAGAAAAAA AAACGTAACCTTTTTTG-3'; DDX11 shRNA: 5'-CCGG CCGTCTAGATGACGAGTTTATCTCGAGATAAACTCGT CATCTAGACGGTTTTTG-3'.
Western blot analysis
Protease inhibitor-containing radioimmunoprecipitation assay buffer was used to lyse the cells. A bicinchoninic acid assay protein assay kit (PC0020, Solarbio, Beijing, China) was used to measure the amount of protein in the supernatant, and a 5× sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (BL529B, Biosharp, Anhui, China) was combined with 30 μg of each protein sample. Proteins were separated by SDS-PAGE using Bio-Rad Mini-PROTEAN Tetra Vertical Electrophoresis System (Bio-RAD, Hercules, CA, USA) at 120 V for 90 min and then transferred to polyvinylidene fluoride membranes (IPVH00010, Millipore Corporation, Billerica, MA, USA) with Bio-Rad Trans-Blot Transfer System at 300 mA for 90 min. The membranes were blocked with 5% non-fat milk, and incubated overnight at 4°C with rabbit antibodies for DDX11 (1:1000, #11560-1-AP, Proteintech, Hubei, Chian) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:1000, #AC002, ABclonal, Hubei, China). The membranes were then incubated with a secondary antibody (1:1000, #7074, CST, BSN, Ma, USA) for 1 h at room temperature. Protein bands were visualized using ECL reagent (BL520b, Biosharp, Anhui, China) on a Bio-Rad ChemiDoc MP Imaging System (Bio-RAD, Hercules, CA, USA).
Co-immunoprecipitation assay
Total protein (1 mg) was incubated with 2 μg of rabbit anti-human DDX11 monoclonal antibody or rabbit anti-human ATAD5 monoclonal antibody (#ab72111, Abcam, Cambridge, MA, USA) and 40 μL of protein A/G magnetic beads (#88802, Thermo Fisher Scientific, Waltham, MA, USA) at 4°C for 8 h. The proteins were eluted at 95°C for 10 min after the bead– antibody complexes were treated with cell lysates for an entire night at 4°C and then rinsed 3 times with phosphate buffer saline (PBS, P1010, Solarbio, Beijing, China). Rabbit immunoglobulin G (IgG) (#2729, CST, BSN, Ma, USA) served as the negative control, and co-precipitated proteins were detected through Western blot to verify DDX11–ATAD5 interactions.
Quantitative real-time polymerase chain reaction (qRT-PCR) analysis
Total RNA was extracted using TRIzol reagent (#15596026, Invitrogen, Carlsbad, CA, USA) and purified using RNA extraction kit (EZB-VRN1, EZBiosience, Jiangsu, China). Reverse transcription was performed using PrimeScript RT Master Mix (#RR036A, Yeasen, Shanghai, China), with 1 μg total RNA per reaction. qRT-PCR was conducted on an ABI QuantStudio 6 Flex real-time PCR system (4485689, Thermo Fisher Scientific, Waltham, MA, USA) in 20 μL reactions containing 10 μL of 2× SYBR Green PCR Master Mix (#RR420A, Yeasen, Shanghai, China), 0.4 μL of forward and reverse primers (10 μM each), 2 μL of cDNA template, and 7.2 μL of nuclease-free water. Relative expression was calculated using the 2−ΔΔCt method with GAPDH as the internal control. The primer sequences are listed in Table 1.
| Primer name | Forward | Reverse |
|---|---|---|
| E-Cadherin | 5'-CGAGAGCTACACGTTCACGG-3' | 5'-GGGTGTCGAGGGAAAAATAGG-3' |
| Vimentin | 5'-GACGCCATCAACACCGAGTT-3' | 5'-CTTTGTCGTTGGTTAGCTGGT-3' |
| GAPDH | 5'-CCAGCGACTAGCCGCCTACGTACGAC-3' | 5'-GCTGCATGCTGCAAGCTACCTACAAG-3' |
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
5-ethynyl-2'-deoxyuridine (EdU) cell proliferation assay
GBC-SD and NOZ cells were seeded in 24-well plates (#3524, Corning Incorporated, Corning, NY, USA) at 1 × 105 cells/well and cultured for 24 h. Transfection was then performed, and the cells were cultured for 24 h. The cells were incubated with 10 μmol/L EdU working solution (#C0075S, Beyotime, Shanghai, China) for 2 h, washed with PBS, and fixed with 4% paraformaldehyde (#158127, Sigma-Aldrich, St. Louis, MO, USA) for 15 min at room temperature. Apollo staining was performed using an EdU-555 cell proliferation detection kit (#C0075S, Beyotime, Shanghai, China), followed by nuclear staining with PBS containing 1 μg/mL 4',6-diamidino-2-phenylindole (DAPI, #D9542, Sigma-Aldrich, St. Louis, MO, USA) for 5 min. The IX73 inverted fluorescent microscope (Olympus Corporation, Tokyo, Japan) was used to take photographs.
ImageJ (v1.53, National Institutes of Health, Bethesda, MD, USA) was used to count the number of EdU-positive cells (red fluorescence) and total cells (DAPI blue fluorescence) (EdU-positive cells/total cells) × 100% was the formula used to determine the EdU-positive rate (%). Every experiment was carried out 3 times.
Colony formation assay
The cells (1 × 103 cells/well) were fixed for 1 h at room temperature with 4% paraformaldehyde and stained for 8 min with a 0.1% crystal violet solution (#V5265, Sigma-Aldrich, St. Louis, MO, USA). After washing with PBS twice, THE plates were dried at 37°C for 1 h. Images were captured using an Epson V850 Pro scanner (Honshu, Japan).
Transwell assays
GBC-SD and NOZ cells were suspended in serum-free DMEM at 1.5 × 105 cells/mL. The cells were fixed with 4% paraformaldehyde for 15 min and stained with 0.1% crystal violet for 30 min following a 48 h incubation period at 37°C. For invasion assays, the upper chambers were precoated with 100 μL of diluted Matrigel (1 mg/mL in serum-free DMEM, #356234, BD Biosciences, Franklin Lake, New Jersey, USA) and incubated at 37°C for 4 h. Five random fields at 400× magnification were photographed using an IX73 inverted microscope, and transmigrated cells were counted.
TUNEL apoptosis assay
Cell coverslips were fixed with 4% paraformaldehyde for 20 min. Following 90 min of room temperature blocking with 5% bovine serum albumin (BSA, #A2153, Sigma-Aldrich, St. Louis, MO, USA), the cells were permeabilized for 10 min on ice with 0.3% Triton X-100 (#T8787, Sigma-Aldrich, St. Louis, MO, USA). Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL, #11684795910, Roche, Basel, Switzerland) reaction mixture was prepared, and 60 μL was added to each coverslip for overnight incubation at 4°C in the dark. After PBS washing, the nuclei were counterstained with DAPI for 3 min. The images were captured using Leica SP8 confocal microscope (Wetzlar, Germany), with five random fields per group. The mean fluorescence intensity of TUNEL-positive cells (green fluorescence) was analyzed using ImageJ software to evaluate apoptosis levels, and each experiment was repeated 3 times.
Immunofluorescence co-localization assay
Cells were cultivated for 24 h after being seeded at a density of 1 × 105 cells/well on coverslips in 24-well plates, transfected for 24 h, fixed for 15 min with 4% paraformaldehyde, permeabilized for 10 min with 0.3% Triton X-100, and blocked for 1 h at room temperature with 5% BSA. The cells were incubated with DDX11 antibody (1:200) and ATAD5 antibody (1:200) overnight at 4°C. After PBS washing, the cells were incubated with Alexa Fluor 555-conjugated goat anti-rabbit IgG (1:500, A-21428, Invitrogen, Carlsbad, CA, USA) and Alexa Fluor 488-conjugated goat anti-mouse IgG (1:500, #A32723, Invitrogen, Carlsbad, CA, USA) for 1 h at room temperature in the dark. Under a Leica SP8 confocal microscope, the nuclei were counterstained with DAPI for 5 min to examine the co-localization of DDX11 (red) and ATAD5 (green).
Cytoskeleton staining
BGC-SD and NOZ cells were fixed with 4% paraformaldehyde for 15 min and incubated with 0.3% Triton X-100 at room temperature for 10 min. Phalloidin labeled with Alexa Fluor 594 (1:200, #A12381, Invitrogen, Carlsbad, CA, USA) was incubated at room temperature for 30 min for dark staining followed by nuclear back-staining with DAPI for 5 min. Coverslips were mounted using anti-fade mounting medium. F-actin distribution (red fluorescence) was observed and photographed using an IX73 inverted fluorescence microscope to compare the effects of DDX11 expression changes on cytoskeleton remodeling. Each experiment was repeated 3 times.
Tail vein injection metastasis model in nude mice
Female BALB/c nu/nu mice (5-6 weeks old, Beijing Vital River Laboratory Animal Technology Co., Ltd.) were maintained on a 12 h light–12 h dark cycle at 23 ± 1°C and had free access to food and water. All mice were randomly divided into Mock control and DDX11 overexpression groups (n = 6 per group). Stably transfected GBC-SD cells (1 × 106) suspended in 100 μL of PBS were injected through tail vein after anesthesia with 3% pentobarbital sodium (50 mg/kg, #P3761, Sigma-Aldrich, St. Louis, MO, USA). Body weight was measured every 3 days, and the mice were euthanized by cervical dislocation after 6 weeks. Following collection, lung tissues were embedded in paraffin, sectioned (4 μm thickness), and fixed in 10% neutral buffered formalin (#HT501128, Sigma-Aldrich, St. Louis, MO, USA) for 24 h. Hematoxylin and eosin (H&E) staining was performed using an H&E Staining Kit (#HHS32, Sigma-Aldrich, St. Louis, MO, USA), and lung metastatic nodules were observed and recorded under an OLYMPUS BX53 microscope. All animal experiments were approved by the Institutional Animal Ethics Committee.
Immunohistochemistry
Hydrogen peroxide (3%; #216763, Sigma-Aldrich, St. Louis, MO, USA) for 10 min. Antigen retrieval was performed in sodium citrate buffer (pH 6.0, #C9999, Sigma-Aldrich, St. Louis, MO, USA) at 95°C for 10 min. After PBS washing, sections were blocked with 5% BSA for 30 min at room temperature, followed by incubation with DDX11 antibody for 1 h at 37°C. The secondary antibody was applied for 30 min at 37°C, and immunoreactivity was visualized using a DAB substrate kit (#SK-4100, Vector Laboratories, Shenzhen, China). The sections underwent hematoxylin counterstaining, xylene clearing, graded alcohol dehydration, and neutral balsam mounting (#G8257, Sigma-Aldrich, St. Louis, MO, USA). The percentage of DDX11-positive cells was analyzed using ImageJ software.
Cell counting kit-8 (CCK-8) assay
The viability of BGC-SD and NOZ cells was determined using a CCK-8 kit (40203ES80, Yeasen, Shanghai, China).
The cells were cultured in 96-well plates with 100 μL of cell suspension at 37°C and 5% CO2 and 10 μL of CCK-8 solution was added to each well. The cells were incubated in an incubator for 2 h, and absorbance at 450 nm with an enzyme-labeled instrument (iD5, Molecular Devices, Sunnyvale, Silicon Valley, USA).
Immunofluorescent staining
The log-grown BGC-SD and NOZ cells were immobilized with 4% paraformaldehyde and then permeated with 0.5% Triton X-100 for 20 min. The primary antibody of ATAD5 (1:1000) was incubated overnight at 4°C, and the secondary antibody (A-11034, 1:1000, Thermo Fisher Scientific, Waltham, MA, USA) was incubated at room temperature. After washing with PBS, it was incubated with DAPI for 15 min. Finally, the tissue was observed through fluorescence microscopy, and the fluorescence intensity was analyzed with Image J.
Statistical analysis
Statistical analyses were performed using GraphPad Prism 8.0.2 software, and data were presented as mean ± standard deviation. Comparisons between two groups were analyzed using independent-samples t-test, whereas multiple group comparisons were conducted using one-way analysis of variance and Tukey’s multiple range tests. P < 0.05 indicated statistically significance. Each experiment was independently repeated 3 times.
RESULTS
DDX11 is Upregulated in GBC
To investigate the role of DDX11 in GBC development, we first analyzed two independent GBC gene expression datasets (GSE202479 and GSE139682) from the GEO database. Hierarchical clustering analysis revealed distinct gene expression profiles between GBC and adjacent normal tissues, indicating tumor-specific transcriptional characteristics [Figure 1a and b]. Principal component analysis further confirmed these findings, with the first two principal components effectively distinguishing GBC tissues from adjacent normal tissues. It demonstrated significant biological differences between the two sample groups [Figure 1c and d]. To systematically identify differentially expressed genes in the GBC tissues, we performed volcano plot analysis. Numerous significantly up- and downregulated genes were identified in the GBC tissues. Notably, DDX11 (log2FC > 1, adjusted P < 0.05) was located in the significantly upregulated region, demonstrating its potential role in GBC development [Figure 1e and f]. Further analysis of DDX11 expression levels revealed significantly higher mRNA expression levels in the GBC tissues (P < 0.05), a finding validated in both independent datasets [Figure 1g and h]. These bioinformatic analyses revealed the aberrant expression pattern of DDX11 in GBC, establishing a foundation for further functional and mechanistic studies.

- DDX11 is upregulated in GBC. (a and b) Cluster analysis showing differential gene expression patterns between the control and tumor groups. (c and d) Principal component analysis demonstrating distinct separation between the control and tumor groups. (e and f) Volcano plot displaying differentially expressed genes between adjacent normal and GBC tissues (DDX11 position indicated). A green dot indicates a downward adjustment, red dot indicates an upward adjustment, and gray dot indicates no significant difference. (g and h) DDX11 mRNA expression levels were significantly higher in the GBC tissues. Data from GSE202479 and GSE139682 datasets.✶P < 0.05. DDX11: DEAD/H-box helicase 11, GBC: Gallbladder cancer, mRNA: Messenger ribonucleic acid.
DDX11 promotes GBC cell proliferation
To investigate the role of DDX11 in GBC cell proliferation, we established stable DDX11-overexpressing NOZ and GBC-SD cell lines. Figure 2a-d demonstrates significantly increased target protein expression levels in the DDX11-overexpressing groups compared with control and empty vector (MOCK) groups. DDX11 protein levels were elevated approximately threefold in the NOZ cells and fourfold in the GBC-SD cells, confirming the successful establishment of stable DDX11-overexpressing cell lines. To evaluate the effect of DDX11 overexpression on GBC cell proliferation, we first performed EdU incorporation assays. The results showed significantly higher EdU-positive rates in the DDX11-overexpressing cells (P < 0.01) in the NOZ and GBC-SD cells, indicating that DDX11 promotes DNA synthesis and cell cycle progression [Figure 2e-h]. To further validate these findings, we conducted colony formation assays. The DDX11-overexpressing groups exhibited considerably more colonies than the control and MOCK groups (P < 0.001), an observation consistent across both NOZ and GBC-SD cell lines [Figure 2i-l]. As shown in Figure 2m and n, NOZ and GBS-CD cell activity increased significantly in DDX11 group (P < 0.01). Finally, the fluorescence intensity of ATAD5 increased significantly in NOZ and GMS-CD cells overexpressing DDX11 (P < 0.001); [Figure 2o-r]. These findings were validated in two different GBC cell lines, demonstrating the universal nature of DDX11’s proliferation-promoting effects in GBC cells. Collectively, these results indicate that DDX11 overexpression considerably enhances the proliferative capacity of GBC cells. In addition, the overexpression of CCX11 promoted ATAD5 levels.

- DDX11 promotes GBC cell proliferation. (a-d) Western blot analysis of DDX11 expression in NOZ and GBC-SD cells stably expressing MOCK or DDX11. (e-h) EdU incorporation assay showing cell proliferation in NOZ and GBC-SD cells with stable DDX11 expression. Scale bar = 50 μm. Objective = ×40. (i-l) Colony formation assay and quantification of relative colony numbers in NOZ and GBC-SD cells with stable MOCK or DDX11 expression. (m and n) The activity of BGC-SD and NOZ cells was analyzed by CCK-8 assay. (o-r) Immunofluorescence staining ATAD5. Scale bar= 50 μm. Objective = ×40. Data are presented as mean ± SD from three independent experiments. n = 3. ✶✶P < 0.01, ✶✶✶P < 0.001. DDX11: DEAD/H-box helicase 11, GBC: Gallbladder cancer, CCK-8: Cell counting kit-8, SD: Standard deviation.
DDX11 silencing inhibits proliferation and induces apoptosis in GBC cells
To further validate the role of DDX11 in GBC cell proliferation, we established stable DDX11-knockdown NOZ and GBC-SD cell lines. Figure 3a-d shows that the expression of DDX11 protein in the shDDX11 group was significantly reduced (P < 0.01, confirming effective DDX11 knockdown. EdU incorporation assays demonstrated that DDX11 knockdown significantly suppressed DNA synthesis activity in both NOZ and GBC-SD cells (P < 0.01); [Figure 3e-h]. Colony formation assays further confirmed significantly reduced colony-forming ability in DDX11 knockdown groups (P < 0.01), indicating that DDX11 expression is crucial for maintaining GBC cell proliferation [Figure 3i-l]. Notably, we found that DDX11 knockdown inhibited cell proliferation but also induced apoptosis. TUNEL assay results showed significantly increased TUNEL-positive cells in DDX11 knockdown groups (P < 0.001), suggesting that DDX11 knockdown promotes GBC cell apoptosis [Figure 3m-p]. Transwell results showed that the migration and invasion ability of THE NOZ and BGC-SD cells substantially decreased after DDX11 silencing (P < 0.001), [Figure 3q-v]. This finding indicates that DDX11 promotes GBC cell survival by suppressing apoptosis. Overall, these results were reproducible in NOZ and GBC-SD cell lines, and no significant differences were observed between the control and negative control groups, demonstrating the reliability and universality of our findings. These observations, together with the DDX11 overexpression results, further confirmed the crucial role of DDX11 in promoting GBC cell proliferation and suppressing apoptosis.

- DDX11 knockdown inhibits GBC cell proliferation and induces apoptosis. (a-d) Western blot analysis of DDX11 expression in control and shDDX11 cells. (e-h) EdU incorporation assay in control and shDDX11 cells. Scale bar = 50 μm. Objective = ×40. (i-l) Colony formation assay and quantification in control and shDDX11 cells. (m-p) TUNEL assay showing apoptotic cells in control and shDDX11 groups. Scale bar = 50 μm. Objective = ×40. (q-v) Transwell was used to analyze the migration and invasion ability of NOZ and BGC-SD cells. Scale bar = 100 μm. Objective = ×20. Data are presented as mean ± SD from three independent experiments. n = 3. ✶✶P < 0.01, ✶✶✶P < 0.001. DDX11: DEAD/H-box helicase 11, GBC: Gallbladder cancer, EdU: 5-ethynyl-2'-deoxyuridine, SD: Standard deviation.
DDX11 promotes migration and invasion of GBC cells
To investigate the role of DDX11 in GBC cell migration and invasion, we first performed Transwell assays. The results showed significantly increased numbers of migrating and invading cells in the DDX11-overexpressing NOZ and GBC-SD cells (P < 0.001); [Figure 4a-d]. Morphological observations revealed substantial changes in GBC cells following DDX11 overexpression. The immunofluorescence staining of the cytoskeleton showed that the DDX11-overexpressing cells’ morphology transformed from a round epithelial-like to spindle-shaped mesenchymal-like and cell length considerably increased (P < 0.05); [Figure 4e-h]. These morphological changes suggested that DDX11 promoted GBC cell migration and invasion through EMT induction. To elucidate the mechanism of DDX11 action, we performed KEGG pathway enrichment analyses on the GBC and adjacent normal tissues. The results showed considerable enrichment in EMT-related cell migration and tumor metastasis pathways [Figure 4i], providing bioinformatic evidence of DDX11-mediated GBC progression through EMT. Furthermore, qRT-PCR analysis of EMT markers revealed that DDX11 overexpression significantly decreased expression of the epithelial marker E-cadherin (P < 0.001); [Figure 4j] while upregulating the mesenchymal marker vimentin (P < 0.01); [Figure 4k]. These molecular changes corroborated the morphological observations, confirming that DDX11 induces EMT in GBC cells.

- DDX11 promotes GBC cell migration and invasion. (a-d) Transwell assay showing the relative cell numbers in MOCK- or DDX11-expressing cells. Scale bar = 100 μm. Objective = ×40. (e-h) Immunofluorescence staining of F-actin showing morphological changes in the NOZ and GBC-SD cells after DDX11 overexpression. Scale bar = 20 μm. Objective= 100×. (i) GO and KEGG pathway analysis showing the enrichment of EMT-related migration and invasion functions in GBC tissues compared with adjacent tissues. (j and k) qRT-PCR analysis of epithelial marker E-cadherin (j) and mesenchymal marker vimentin (k) expression in MOCK and DDX11-overexpressing cells. Data are presented as mean ± SD from three independent experiments. n = 3. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. DDX11: DEAD/H-box helicase 11, GBC: Gallbladder cancer, EMT: Epithelial–mesenchymal transition, SD: Standard deviation, qRT-PCR: Quantitative real-time polymerase chain reaction.
DDX11 interacts with ATAD5 in GBC and ATAD5 is overexpressed in GBC
To investigate the mechanism of DDX11 action, we first predicted DDX11’s protein interaction network through bioinformatic analysis. The results identified ATAD5 as a potential DDX11-interacting protein [Figure 5a]. To validate this prediction, we performed coimmunoprecipitation experiments. ATAD5 was detected in DDX11 immunoprecipitates, and conversely, DDX11 was detected in ATAD5 immunoprecipitates. Moreover, no corresponding signals were detected in IgG control groups, confirming direct protein interaction between DDX11 and ATAD5 [Figure 5b and c]. Immunofluorescence co-localization experiments revealed the nuclear co-localization of DDX11 (red fluorescence) and ATAD5 (green fluorescence), appearing as yellow fluorescence in the GBC cells and further supporting their interaction [Figure 5d]. To explore the clinical significance of DDX11–ATAD5 interaction, we analyzed GBC gene expression datasets (GSE202479 and GSE139682) from the GEO database. The results showed significantly higher ATAD5 mRNA expression in the GBC tissues (P < 0.05); [Figure 5e and f]. Notably, correlation analysis revealed a significant positive correlation between DDX11 and ATAD5 expression levels (r = 0.82, P = 9.2 × 10−6); [Figure 5g], suggesting their potential synergistic role in GBC development. These results confirm the functional association between DDX11 and ATAD5 at multiple levels, including protein interaction, subcellular localization, and clinical expression correlation, establishing a foundation for investigating the mechanistic role of the DDX11–ATAD5 complex in GBC progression.

- DDX11 interacts with ATAD5. (a) Predicted protein–protein interaction network of DDX11. The images were drawn using cytoscape software. (The Cytoscape Consortium, San Diego, CA, USA) (b and c) Co-immunoprecipitation assay confirming interaction between DDX11 and ATAD5. (d) Immunofluorescence showing co-localization of DDX11 and ATAD5. Scale bar = 5 μm. Objective = ×400. (e and f) ATAD5 mRNA levels in GBC tissues (GSE202479 and GSE139682 datasets). (g) Correlation analysis showing positive correlation between DDX11 and ATAD5 expression in GBC tissues (P = 9.2 × 10−6; r = 0.82). ✶P < 0.05, ✶✶✶P < 0.001. DDX11: DEAD/H-box helicase 11, GBC: Gallbladder cancer, SD: Standard deviation, mRNA: Messenger ribonucleic acid.
ATAD5 silencing reverses the oncogenic functions of DDX11 in NOZ cells
To further validate the hypothesis that DDX11 promotes GBC progression through interaction with ATAD5, we knocked down ATAD5 expression in the DDX11-overexpressing NOZ cells. Western blot analysis showed that shATAD5 transfection considerably reduced ATAD5 protein expression without affecting DDX11 expression, confirming the specificity of ATAD5 knockdown [Figure 6a and b]. EdU assay results showed that compared with the control group (MOCK + shNC), the DDX11 overexpression (DDX11 + shNC) group exhibited significantly increased EdU-positive cell numbers (P < 0.001). However, under ATAD5 knockdown conditions (DDX11 + shATAD5), the proliferation-promoting effect of DDX11 overexpression was significantly suppressed, with cell proliferation activity returning to control levels (P < 0.001). Notably, ATAD5 knockdown alone (MOCK + shATAD5) reduced cell proliferation capacity [Figure 6c and d], and Transwell assays further confirmed that ATAD5 knockdown considerably suppressed DDX11 overexpression-induced enhancement of cell invasion. DDX11 overexpression markedly increased invasive cell numbers, but this effect was mitigated under ATAD5 knockdown conditions (P < 0.01); [Figure 6e and f]. To investigate the impact of ATAD5 knockdown on DDX11-induced EMT, we examined EMT marker expression changes. The qRT-PCR results showed that DDX11 overexpression considerably decreased epithelial marker E-cadherin expression, whereas ATAD5 knockdown reversed this effect and restored E-cadherin expression to control levels [Figure 6g]. Correspondingly, mesenchymal marker vimentin expression was considerably upregulated in the DDX11 overexpression group, while ATAD5 knockdown suppressed this effect [Figure 6h]. These results indicate that ATAD5 expression is crucial for DDX11’s functions in promoting GBC cell proliferation, invasion, and EMT, supporting the mechanism by which DDX11 promotes GBC progression through interactions with ATAD5.

- ATAD5 knockdown reverses the oncogenic effects of DDX11 in NOZ cells. (a and b) Western blot verification of shATAD5 transfection efficiency. (c and d) EdU incorporation assay in transfected NOZ cells. Scale bar = 50 μm. Objective = ×40. (e and f) Transwell invasion assay in transfected NOZ cells. Scale bar = 100 μm. Objective = ×20. (g and h) qRT-PCR analysis of E-cadherin (g) and vimentin (h) expression in transfected NOZ cells. Groups: MOCK + shNC, MOCK + shATAD5, DDX11 + shNC, DDX11 + shATAD5. Data are presented as mean ± SD from three independent experiments. n = 3. ✶✶P < 0.01, ✶✶✶P < 0.001. DDX11: DEAD/H-box helicase 11, qRT-PCR: Quantitative real-time polymerase chain reaction, SD: Standard deviation.
DDX11 overexpression promotes tumor metastasis in nude mice
To validate the pro-metastatic effect of DDX11 in vivo, we established a tail vein injection metastasis model in nude mice. NOZ cells stably overexpressing DDX11 or empty vector (MOCK) were injected into the tail veins of nude mice and monitored for 6 weeks. H&E staining revealed a significant increase in the number of lung metastatic nodules in the DDX11 overexpression group (P < 0.01). Furthermore, metastatic nodules in the DDX11 overexpression group were generally larger and exhibited prominent invasive growth characteristics [Figure 7a]. As shown in Figure 7b, the number of pulmonary metastases increased significantly in the DDX11 group (P < 0.001). To further confirm DDX11 and ATAD5 expression in metastatic nodules, we performed immunohistochemical staining analysis. The results showed considerably elevated DDX11 protein expression with distinct nuclear localization in the lung metastatic nodules of the DDX11 overexpression group [Figure 7c and d]. Notably, ATAD5 expression was markedly increased in the metastatic nodules of the DDX11 overexpression group [Figure 7e and f], consistent with the DDX11–ATAD5 co-expression pattern observed in our in vitro experiments. A quantitative analysis of immunohistochemical staining further confirmed that the positive rate and staining intensity of DDX11 and ATAD5 were significantly higher in the metastatic nodules of the DDX11 overexpression group (P < 0.01). These in vivo experimental results validate the pro-metastatic role of DDX11 in GBC and support the molecular mechanism underlying the influence of DDX11–ATAD5 interactions in promoting tumor progression.

- DDX11 promotes tumor metastasis in nude mice. (a and b) H&E staining showing lung metastatic nodules 6 weeks after tail vein injection of NOZ cells stably expressing DDX11 or MOCK vector. Scale bar = 150 or 200 μm. Objective= 10×. (c-f) Representative immunohistochemical staining images showing DDX11 (c and d) and ATAD5 (e and f) expression in lung metastatic nodules. Scale bars = 100 μm. Objective = ×20. Data are presented as mean ± SD. n = 3. ✶✶P < 0.01, ✶✶✶P < 0.001. DDX11: DEAD/H-box helicase 11, H&E: Hematoxylin and eosin, SD: Standard deviation.
DISCUSSION
This study reveals the crucial role of DDX11–ATAD5 protein interaction in GBC progression and elucidates its molecular mechanism in promoting malignant GBC progression through EMT regulation. Our investigation yielded three key findings: First, DDX11 and ATAD5 are overexpressed in the GBC tissues and exhibit direct PPI. Second, DDX11 promotes GBC cell proliferation and suppresses apoptosis through its interaction with ATAD5. Finally, the DDX11– ATAD5 complex enhances GBC cell migration and invasion by facilitating EMT, thereby promoting tumor metastasis.
Our findings provide interesting contrasts and complementary insights into the literature. Previous studies have shown that DDX11 primarily exerts its oncogenic effects through cell cycle regulation and DNA damage repair.[11,13,25] For example, in liver cancer, DDX11 promotes tumor cell survival by inhibiting DNA double-strand break repair in BRCA2-RAD51.[13] Yang et al.[26] reported that DDX11 is transcriptionally regulated by Yin Yang-1, and this regulatory mechanism appears to play a crucial role in promoting the progression of oral squamous cell carcinoma. Our study reveals a novel mechanism by which DDX11 regulates EMT through protein interaction with ATAD5. Regarding ATAD5 function, previous research has primarily focused on its role in DNA replication and repair.[16-18,27] Kim et al. reported that ATAD5 participates in DNA damage repair by regulating PCNA ubiquitination.[27] Lee et al. discovered that ATAD5 influences chromatin structure by modulating histone modification.[28] Notably, our study reveals ATAD5’s novel function in EMT regulation, expanding our understanding of its roles. More importantly, we found that the synergistic action of DDX11 and ATAD5 is essential for promoting EMT possibly by affecting chromatin structure and altering EMT-related gene expression patterns. Regarding EMT regulatory mechanisms, previous studies have mainly focused on transcription factors (such as Snail, Twist, and ZEB1/2). For example, Zhang et al. reported that transforming growth factor-b induces EMT through Smad signaling pathway activation.[29] Xue et al. found that the Wnt/b-catenin signaling pathway directly regulates EMT-related transcription factor expression.[30] Our study reveals a novel EMT regulatory mechanism: the DDX11–ATAD5 complex regulation of EMT-related gene expression. This finding not only adds new components to the EMT regulatory network but also provides new perspectives for understanding the molecular basis of GBC invasion and metastasis. In addition, we observed unique phenomena: the DDX11–ATAD5 complex affects EMT marker expression and promotes tumor cell migration by regulating cytoskeleton reorganization. These mechanistic discoveries deepen our understanding of GBC development but also provide theoretical foundations for developing new therapeutic strategies. For instance, small molecule inhibitors targeting DDX11–ATAD5 interaction can represent a novel class of antitumor drugs, aligning with current clinical strategies targeting PPIs.
The important academic contributions of this study are threefold: First, we revealed a novel molecular mechanism involving DDX11–ATAD5 protein interaction in GBC progression, enriching our understanding of GBC pathogenesis. Second, we demonstrated the molecular mechanism by which the DDX11–ATAD5 complex promotes GBC metastasis through EMT regulation, explaining the molecular basis of GBC’s high invasiveness and laying the theoretical foundation for developing new therapeutic strategies. Finally, our findings suggest that DDX11 and ATAD5 are potential diagnostic and prognostic biomarkers for GBC, indicating potential clinical applications.
Despite these important findings, several limitations warrant further investigation. First, the precise mechanism by which the DDX11–ATAD5 complex regulates EMT-related gene expression requires deeper exploration, particularly regarding its interaction with transcription factors and effects on chromatin structure. Second, the relationship between DDX11 and ATAD5 expression and clinical outcomes in patients with GBC needs validation with larger clinical cohorts. Finally, the feasibility of developing targeted therapies based on DDX11–ATAD5 interaction merits further investigation. Future research directions should focus on (1) elucidating the molecular mechanisms of EMT regulation by the DDX11–ATAD5 complex, (2) exploring the relationship between DDX11 and ATAD5 expression levels and clinical characteristics of GBC, and (3) developing and evaluating small molecule inhibitors targeting DDX11–ATAD5 interactions. These studies will contribute to a deeper understanding of GBC pathogenesis and provide crucial evidence for developing novel therapeutic strategies.
SUMMARY
This study reveals the crucial role of DDX11–ATAD5 protein interactions in GBC progression. We found that DDX11 and ATAD5 are overexpressed in GBC tissues and exhibit direct PPI. Mechanistic studies demonstrated that DDX11 promotes EMT by interacting with ATAD5 and thereby enhances GBC cell proliferation, migration, and invasion. In vivo experiments further confirmed that DDX11 overexpression promotes GBC metastasis. Notably, ATAD5 silencing reversed the oncogenic effects mediated by DDX11, indicating that ATAD5 is essential for DDX11’s biological functions. These findings reveal a novel mechanism regulating GBC progression and offer a theoretical basis for developing targeted therapeutic strategies against DDX11– ATAD5 interaction, demonstrating considerable potential for clinical translation.
AVAILABILITY OF DATA AND MATERIALS
The datasets used and analyzed during the present study were available from the corresponding author on reasonable request.
ABBREVIATIONS
ATAD5: ATPase family AAA domain containing 5
CCK-8: Cell counting kit-8
DAPI: 4',6-diamidino-2-phenylindole
DDX11: DEAD/H-box helicase 11
DMEM: Dulbecco’s modified eagle medium
DNA: Deoxyribonucleic acid
EMT: Epithelial–mesenchymal transition
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
GBC: Gallbladder cancer
GEO: Gene Expression Omnibus
GO: Gene Ontology
IgG: Immunoglobulin G
KEGG: Kyoto Encyclopedia of Genes and Genomes
PBS: Phosphate buffer saline
PPI: Protein–protein interaction
qRT-PCR: Quantitative real-time polymerase chain reaction
RNA: Ribonucleic acid
SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis
STR: Short tandem repeat
TUNEL: Terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling
AUTHOR CONTRIBUTIONS
LK and WL: Designed the study; HLY and LK: Collected and analyzed the data; HLY and WSK: Participated in drafting the manuscript. All authors conducted the study. All authors contributed to critical revision of the manuscript for important intellectual content. All authors gave final approval of the version to be published. All authors participated fully in the work, took public responsibility for appropriate portions of the content, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or completeness of any part of the work were appropriately investigated and resolved. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Shanghai Putuo District Central Hospital. The study was approved by the Institutional Animal Care and Use Committee of Shanghai Putuo District Central Hospital (DWEC-A-2024-19-1-89). Informed consent to participate is not required, as this study does not involve human subjects.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Fund projects: Methylation analysis of tumor suppressor genes in gallbladder carcinoma and its value in early diagnosis of gallbladder carcinoma: 2017-KY-01.
References
- Current management of incidental gallbladder cancer: A review. Int J Surg. 2022;98:106234.
- [CrossRef] [PubMed] [Google Scholar]
- Worldwide distribution, associated factors, and trends of gallbladder cancer: A global country-level analysis. Cancer Lett. 2021;521:238-51.
- [CrossRef] [PubMed] [Google Scholar]
- Pre-activated nanoparticles with persistent luminescence for deep tumor photodynamic therapy in gallbladder cancer. Nat Commun. 2023;14:5699.
- [CrossRef] [PubMed] [Google Scholar]
- Gallbladder cancer revisited: The evolving role of a radiologist. Br J Radiol. 2021;94:20200726.
- [CrossRef] [PubMed] [Google Scholar]
- Cartilage oligomeric matrix protein promotes epithelial-mesenchymal transition by interacting with transgelin in colorectal cancer. Theranostics. 2020;10:8790-806.
- [CrossRef] [PubMed] [Google Scholar]
- Exosomal long non-coding RNA TRPM2-AS promotes angiogenesis in gallbladder cancer through interacting with PABPC1 to activate NOTCH1 signaling pathway. Mol Cancer. 2024;23:65.
- [CrossRef] [PubMed] [Google Scholar]
- METTL3-mediated N6-methyladenosine modification of DUSP5 mRNA promotes gallbladder-cancer progression. Cancer Gene Ther. 2022;29:1012-20.
- [CrossRef] [PubMed] [Google Scholar]
- Timeless couples G-quadruplex detection with processing by DDX11 helicase during DNA replication. EMBO J. 2020;39:e104185.
- [CrossRef] [PubMed] [Google Scholar]
- Warsaw breakage syndrome associated DDX11 helicase resolves G-quadruplex structures to support sister chromatid cohesion. Nat Commun. 2020;11:4287.
- [CrossRef] [PubMed] [Google Scholar]
- The genome stability maintenance DNA helicase DDX11 and its role in cancer. Genes (Basel). 2021;12:395.
- [CrossRef] [PubMed] [Google Scholar]
- The role of upregulated DDX11 as a potential prognostic and diagnostic biomarker in lung adenocarcinoma. J Cancer. 2019;10:4208-16.
- [CrossRef] [PubMed] [Google Scholar]
- Targeting DDX11 promotes PARP inhibitor sensitivity in hepatocellular carcinoma by attenuating BRCA2-RAD51 mediated homologous recombination. Oncogene. 2024;43:35-46.
- [CrossRef] [PubMed] [Google Scholar]
- Predisposition to cancer caused by genetic and functional defects of mammalian Atad5. PLoS Genet. 2011;7:e1002245.
- [CrossRef] [PubMed] [Google Scholar]
- Rare ATAD5 missense variants in breast and ovarian cancer patients. Cancer Lett. 2016;376:173-7.
- [CrossRef] [PubMed] [Google Scholar]
- ATAD5 deficiency alters DNA damage metabolism and sensitizes cells to PARP inhibition. Nucleic Acids Res. 2020;48:4928-39.
- [CrossRef] [PubMed] [Google Scholar]
- ATAD5 promotes replication restart by regulating RAD51 and PCNA in response to replication stress. Nat Commun. 2019;10:5718.
- [CrossRef] [PubMed] [Google Scholar]
- Timely termination of repair DNA synthesis by ATAD5 is important in oxidative DNA damage-induced single-strand break repair. Nucleic Acids Res. 2021;49:11746-64.
- [CrossRef] [PubMed] [Google Scholar]
- Oncogene 5'-3' exoribonuclease 2 enhances epidermal growth factor receptor signaling pathway to promote epithelial-mesenchymal transition and metastasis in non-small-cell lung cancer. Cytojournal. 2024;21:46.
- [CrossRef] [PubMed] [Google Scholar]
- An epithelialmesenchymal transition-related mRNA signature associated with the prognosis, immune infiltration and therapeutic response of colon adenocarcinoma. Pathol Oncol Res. 2023;29:1611016.
- [CrossRef] [PubMed] [Google Scholar]
- Immunoglobulin superfamily member 1 upregulates myc proto-oncogene to accelerate invasion and metastasis of endometrial cancer: Molecular mechanisms and therapeutic prospects. Cytojournal. 2024;21:49.
- [CrossRef] [PubMed] [Google Scholar]
- Epithelial-to-mesenchymal transition in gallbladder cancer: From clinical evidence to cellular regulatory networks. Cell Death Discov. 2017;3:17069.
- [CrossRef] [PubMed] [Google Scholar]
- Roles of Pin1 as a key molecule for EMT induction by activation of STAT3 and NF-kB in human gallbladder cancer. Ann Surg Oncol. 2019;26:907-17.
- [CrossRef] [PubMed] [Google Scholar]
- Thrombospondin 4/integrin a2/HSF1 axis promotes proliferation and cancer stem-like traits of gallbladder cancer by enhancing reciprocal crosstalk between cancer-associated fibroblasts and tumor cells. J Exp Clin Cancer Res. 2021;40:14.
- [CrossRef] [PubMed] [Google Scholar]
- The DEAD/DEAH box helicase, DDX11, is essential for the survival of advanced melanomas. Mol Cancer. 2012;11:82.
- [CrossRef] [PubMed] [Google Scholar]
- DEAD/Hbox helicase 11 is transcriptionally activated by Yin Yang-1 and accelerates oral squamous cell carcinoma progression. Cell Biol Int. 2024;48:1731-42.
- [CrossRef] [PubMed] [Google Scholar]
- ATAD5-BAZ1B interaction modulates PCNA ubiquitination during DNA repair. Nat Commun. 2024;15:10496.
- [CrossRef] [PubMed] [Google Scholar]
- ATAD5 regulates the lifespan of DNA replication factories by modulating PCNA level on the chromatin. J Cell Biol. 2013;200:31-44.
- [CrossRef] [PubMed] [Google Scholar]
- Signal transduction pathways of EMT induced by TGF-b, SHH, and WNT and their crosstalks. J Clin Med. 2016;5:41.
- [CrossRef] [PubMed] [Google Scholar]
- Wnt/ b-catenin-driven EMT regulation in human cancers. Cell Mol Life Sci. 2024;81:79.
- [CrossRef] [PubMed] [Google Scholar]
