Translate this page into:
Oxoglutarate dehydrogenase-like may alleviate the inflammatory response process of epilepsy by inhibiting JAK/STAT signaling pathway through upregulating collagen type IV alpha 2

*Corresponding author: Hong Chen, Department of Pediatrics, First Affiliated Hospital, Heilongjiang University of Chinese Medicine, Harbin, China. chenhong_1977@163.com
-
Received: ,
Accepted: ,
How to cite this article: Wang W, Song Q, Feng D, Chen Q, Guo T, Chen H. Oxoglutarate dehydrogenase-like may alleviate the inflammatory response process of epilepsy by inhibiting JAK/STAT signaling pathway through upregulating collagen type IV alpha 2. CytoJournal. 2025;22:97. doi: 10.25259/Cytojournal_251_2024
Abstract
Objective:
Despite the availability of many epilepsy drugs, certain epilepsy patients still cannot be treated with medication. The dysfunction of oxoglutarate dehydrogenase-like (OGDHL) is related to neurodegeneration. This article aimed to explore the role of OGDHL on interleukin (IL)-1β-induced epileptic cell model and its molecular mechanism.
Material and Methods:
An epileptic cell model was established using IL-1β. Quantitative real-time polymerase chain reaction was used to detect the expression levels of tumor necrosis factor-α, IL-1β, and IL-6 after different treatments. Western blot was used to detect the recovery effect of OGDHL overexpression on the IL-1-induced epilepsy model of CTX-TNA cells through the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) signaling pathway and collagen type IV alpha 2 (COL4A2) expression level. Meanwhile, the hypertrophy, viability, and apoptosis of CTX-TNA cells were = evaluated through terminal deoxynucleotidyl transferase dUTP nick end labeling staining, cell counting kit-8 assay, and glial fibrillary acidic protein expression. In addition, we evaluated the effect of the JAK/STAT signaling pathway agonist α7nAchR on the effects of OGDHL overexpression. The influence and possible mechanisms of OGDHL overexpression were comprehensively assessed through the above experimental methods.
Results:
Our results suggest that OGDHL overexpression can alleviate IL-1β-induced inflammatory response to epilepsy through the JAK/STAT signaling pathway and significant upregulation of COL4A2 expression level (P < 0.001). In addition, ODGHL overexpression can regulate the hypertrophy and apoptosis of CTX-TNA cells (P < 0.001). The effect of OGDHL overexpression on reducing epileptic inflammatory response was further demonstrated through the intervention of α7nAchR, which serves as an agonist in the JAK/STAT signaling pathway.
Conclusion:
ODGHL overexpression may inhibit the JAK/STAT signaling pathway by upregulating COL4A2 expression, and it inhibited the IL-1β-induced inflammation of CTX-TNA cells in an epileptic model.
Keywords
Collagen type IV alpha 2 inflammatory factor
Epilepsy
Janus kinase/signal transducer and activator of transcription signaling pathway
Oxoglutarate dehydrogenase-like
INTRODUCTION
Epilepsy affects approximately 1% of the global population, and it has gradually become a major public health problem.[1] Most patients with epilepsy take antiepileptic drugs, and their symptoms can be well controlled. However, a third of patients still develop drug resistance.[2] In addition, existing drugs can only control the number of seizures and not prevent or delay disease progression.[3,4] Therefore, to address the problems of drug resistance and prognosis, scholars must find new treatment options.[5]
One of the most prevalent proteins in basement membranes is collagen type IV alpha 2 (COL4A2); the C-terminal portion of this protein can halt tumor growth.[6] Heterotrimers, such as COL4A2 and COL4A1, are essential for the stability and operation of the basement membrane.[7] COL4A2 mutation was first identified in a study on type I poria,[8] which causes infantile hemiplegia,[9] epilepsy,[10] and mental retardation;[11] this information suggests that COL4A2 may be a key protein in epilepsy.
Important Janus kinase (JAK)/signal transducer and activator of transcription (STAT) signaling pathway proteins are crucial epilepsy-regulating factors. The decrease in hippocampus cell damage is mediated by the JAK/ STAT signaling system[12] and promotes the activation of hippocampal glial cells in epileptic rats.[13] In addition, COL4A2 mutations activate astrocytes through JAK/STAT signaling.[14] The JAK/STAT signaling pathway is tightly linked to epilepsy, and reducing its activity reduces epileptic inflammation and results in the generation of novel anti-inflammatory small molecules.[15]
Similar to 2-oxoglutarate dehydrogenase (OGDH), oxoglutarate dehydrogenase-like (OGDHL) is one of the enzymes of the OGDH complex, also called the α-ketoglutarate dehydrogenase complex (KGDHC), that control the rate of several other enzymes. Its physiological effect is intimately linked to the glucose tricarboxylic acid cycle.[16,17] KGDHC comprises three separate subunits: Dihydrolipoamide succinyl transferase, dihydrolipoamide dehydrogenase, and OGDHL.[18,19] An elevated level of OGDHL has been decreased neuroinflammation in Alzheimer’s mice through the activation of the Wnt/β-catenin signaling pathway.[20] However, the potential use and possible mechanism of OGDHL in the pathogenesis of epilepsy remain unclear. This study further elucidates the role of OGDHL in neurodegenerative diseases through a series of experiments.
In summary, we speculate that the increase of OGDHL expression level may affect the expression of inflammatory factors in epileptic seizures with the inhibition of JAK/ STAT signaling pathway after upregulation of COL4A2. In this study, the overexpression of OGDHL was used to investigate its effects on COL4A2 and JAK/STAT signaling and on inflammatory factors. This study aimed to look into the potential mechanism behind ODGHL’s antiepileptic properties. The findings not only provide a new perspective for epilepsy in clinical intervention strategies but also a possible new means for the development of epilepsy treatment.
MATERIAL AND METHODS
Cell culture, grouping, and transfection
CTX-TNA cells (CRL-2006, ATCC, Manassas, VA, USA) were cultured in Dulbecco’s Modified Eagle Medium (12491015, Gibco, Life Technologies, Rockville, MD, USA) containing 10% calf serum (F0193, Sigma, St. Louis, MO, USA) and 1% penicillin–streptomycin mixture (60162ES76, Yeasen, Shanghai, China). The cells were placed in an incubator at 37℃ and 5% carbon dioxide. When the cell density grew to 70–80%, the passage was carried out. The experimental groups were as follows: Control, interleukin (IL)-1β (10 ng/mol, PeproTech, USA), IL-1β+negative control (NC), IL-1β+OGDHL, IL-1β+NC to OGDHL overexpression+si-NC, IL-1β+(OGDHL siRNA) si-OGDHL, and IL-1β+si-OGDHL+(COL4A2 overexpression) OVCOL4A2. The CTX-TNA cells were induced using IL-1β to establish epileptic cell inflammatory response.[21] These cells were also mycoplasma free.
Logarithmic-phase cells with a good growth condition were collected and inoculated into six-well plates 1 day before transfection. The cell density reached 70–80% after 12 h adherence. Before transfection, the cells’ medium was replaced with that without double antibodies. Instructions for Lipofectamine 3000 (L3000001, Thermo Fisher Scientific, Waltham, MA, USA) transfection reagents were followed. Si-OGDHL (OGDHL siRNA, 5’- GCGUCAGUGUCAAGUUGCATT-3’), OGDHL-NC, OGDHL-OE (forwards 5’-TCGCT TGGAGAGCACCTACT-3’, reversed 5’-CCTCGACGGAAAACTGCATCA-3’), and OVCOL4A2 (CCTGGCCGCCCAGGGCCAATAGGACAGAT GGGTCCCATGGGAGCACCTGGAAGACCGGGACCAC CAGGACCCCCTGGACCCAAAGGACAACCAGGCAAC CGAGGACTGGGTTTTTACGGAGAGAAGGGTGAAA AGGGTGACGTAGGACAGCCAGGACCCAATGGGAT CCCATCTGACATCACACTCATTGGGCCCACGCCATC AACGTATCACCCGGATATGTACAAGGGTGAAAAGGG AAGTCAAGGAGAGCCAGGGATACCCGGCATAAC CTTAAAAGGCGAGGAAGGCATCATGGGATTCCCAG GAACACGGGGTTTTCCTGGCCTTGATGGAGAA AAAGGAGTCTCAGGACAGAAAGGAAGCAGAGGCCT GGATGGTTTCCAAGGCCCCAGTGGACCCCGAGGAC CCAAGGGAGAACGGGGAGAACTAGGACCCCCAGGA CCTCCAGCCTACTCACCCCATCCATCCCTGGCAAAA GGTGCCAGAGGTG) were transfected into cells. At 48 h after transfection, RNA was extracted for transfection efficiency verification.[22]
Enzyme-linked immunosorbent assay (ELISA)
The expression level of COL4A2 in CTX-TNA cells was determined using an ELISA kit. The COL4A2 ELISA kit (CSB-EL005742HU) was purchased from Huamei Biological Engineering Co., LTD, Wuhan, China. The instruction manual was referred to for experimental operation. The results were analyzed using an enzyme-labeled instrument (A96, Mettler Toledo, Zurich, Switzerland).
Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) Staining
The CTX-TNA cells were inoculated in 12-well plates and treated with protease K (20 µg/mL, 3115887001, Merk, Darmstadt, Germary) to increase membrane permeability. Then, they were combined with 50 µL TUNEL reaction mixture and left in a dark incubator for 60 min at 37°C. After washing with phosphate buffer saline (PBS, BL302A, Biosharp Life Science, Hefei, Anhui, China), 4’,6-diamidino-2’-phenylindole (DAPI) solution (C1005, Beyotime Biotechnology, Shanghai, China) was added, and the nuclear was stained for 20 min. It was then sealed and viewed under a fluorescence microscope (CX41-32RFL, Olympus Corporation, Tokyo, Japan). The percentage of apoptotic cells was determined using the formula: Apoptosis rate = (Count of apoptotic cells per field/Total cell count per field) × 100%.
5-Ethynyl-2’-deoxyuridine (EdU) Staining
A total of 1 × 104 cells were inoculated on 96-well plates, added with 100 µL EdU solution (C00054, RIBOBIO, Guangzhou, China), and incubated at 37℃ for 2 h. Then, the cells were washed with PBS for 3 min. After the washing solution was removed, 50 µL 4% paraformaldehyde was added to each well to fix the cells for 30 min. Then, 100 µL permeable solution (0.5% TritonX-100, BL2203A, Biosharp Life Science, Hefei, Anhui, China) was added to each well, and the cells were incubated at room temperature for 15 min. The nuclei were stained with DAPI. Finally, the positive cells were observed under a fluorescence microscope.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total cell RNA was extracted through the TRIzol (19211ES, Yeasen, Shanghai, China) method. The total RNA was reverse transcribed to synthesize complementary DNA in accordance with the instructions of the reverse transcription kit (11155ES, Yeasen, Shanghai, China). Primers were synthesized by Sangon Biotech (Shanghai, China) Co., Ltd. The reaction system was prepared following the instructions for the iQTM SYBR Green Supermix (1708880, Bio-RAD, Hercules, CA, USA). The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the control for normalization [Table 1]. Through the 2-ΔΔCt technique, the target gene’s expression level was determined.
| Forward (5’-3’) | Reverse (5’-3’) | |
|---|---|---|
| IL-1β | TTGACGGACCCCAAAAGATG | AGAAGGTGCTCATGTCCTCA |
| IL-6 | GTTCTCTGGGAAATCGTGGA | TGTACTCCAGGTAGCTATGG |
| TNF-α | TCTCATCAGTTCTATGGCCC | GGGAGTAGACAAGGTACAAC |
| ODGHL | AGCGGAGTCAGCTCCAGTTAT | GGATCTGGTAGGCCCGGAT |
| COL4A2 | GACCGAGTGCGGTTCAAAG | CGCAGGGCACATCCAACTT |
| JAK2 | GGAATGGCCTGCCTTACAATG | TGGCTCTATCTGCTTCACAGAAT |
| STAT3 | CACCTTGGATTGAGAGTCAAGAC | AGGAATCGGCTATATTGCTGGT |
| GAPDH | GTCGTGGAGTCTACTGGCGTCTTCA | TCGTGGTTCACACCCATCACAAACA |
PCR: Polymerase chain reaction, IL: Interleukin, TNF-α: Tumor necrosis factor-α, OGDHL: Oxoglutarate dehydrogenase-like, COL4A2: Collagen type IV alpha 2, JAK: Janus kinase, STAT3: Signal transducer and activator of transcription 3, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
Western blot
Radioimmunoprecipitation assay (R0010, Solarbio, Beijing, China) was used to extract proteins. Protein concentration was detected through bicinchoninic acid assay (BCA, BL521A, Biosharp Life Science, Hefei, Anhui, China) method. Using 5×loading buffer, protein denaturation was conducted at 95℃. Then, 12% separated glue and 5% concentrated glue were prepared. Based on the protein concentration, the sample volume was calculated for electrophoresis. The polyvinylidene fluoride membrane (IPVH00010, Millipore Corporation, Billerica, MA, USA) with constant flow membrane received the protein transfer. Next, 5% skim milk was sealed at room temperature for 2 h, and the primary antibody (1:1000) was added at 4℃ overnight. Tris-buffered saline with tween-20 (TBST) was rinsed 4 times ×10min, and horseradish peroxidase labeled goat anti-rabbit immunoglobulin G(H+L) (1:2000, #7074, CST, BSN, Ma, USA) was added. Incubate at room temperature for 1h, and rinse with TBST for 4 times ×10min. Enhanced chemiluminescence (BL520b, Biosharp Life Science, Hefei, Anhui, China), a chemiluminescence reagent was added, and Image J (v1.8, National Institutes of Health, Bethesda, MD, USA) was used for the analysis. The primary antibodies were as follows: JAK2 (44-406G, 1:1000, Thermo Fisher Scientific, Waltham, MA, USA); STAT3 (PA5-84386, 1:1000, Thermo Fisher Scientific, Waltham, MA, USA); Phospho JAK2 (p-JAK2, 44-426G, 1:1000, Thermo Fisher Scientific, Waltham, MA, USA); Phospho STAT3 (p- STAT3, 710093, 1:1000, Thermo Fisher Scientific, Waltham, MA, USA); glial fibrillary acidic protein (GFAP, PA5-16291, 1:1000, Thermo Fisher Scientific, Waltham, MA, USA); and GAPDH (ab9485, 1:10000, Abcam, Cambridge, MA, USA).
Cell counting kit-8 (CCK-8) assay
CCK-8 assay (C0039, Beyotime Biotechnology, Shanghai, China) was used to determine cell viability. Cells were inoculated at a density of 2 × 103 per well on a 96-well plate. Then, 10 µL CCK-8 solution was added to each well, and the cells were incubated for 1 h. Absorbance was measured at 450 nm using an enzyme-labeled instrument.
Immunofluorescent staining
The CTX-TNA cells were fixed with 4% paraformaldehyde, incubated with 0.5% Triton X-100 for 20 min, and closed with 2% goat serum for 1 h. The primary antibody of GFAP (1:200) was incubated at 4℃ overnight, followed by the secondary antibody (A-21245, 1:1000, Thermo
Fisher Scientific, Waltham, MA, USA) incubated at room temperature. After washing with PBS, the tissues were incubated with DAPI (C0065, Solarbio, Beijing, China) for 15 min. Finally, fluorescence microscopy was performed to observe the tissues, and ImageJ was employed to analyze fluorescence intensity.
Statistical analysis
All data were analyzed using the Statistical Package for the Social Sciences 18.0 (IBM Corp., Armonk, NY, USA) statistical software. Measurement data were expressed as mean ± standard deviation. Comparison between the two groups was performed through t-test. Comparisons among multiple groups were analyzed through one-way analysis of variance followed by Tukey’s test. P < 0.05 was considered statistically significant difference.
RESULTS
Expression levels of COL4A2 and inflammatory factors in epileptic cell models
The IL-6, tumor necrosis factor-α (TNF-α), and IL-1β messenger RNA (mRNA) levels were also increased in the IL-1β group compared with those in the control group [Figure 1a-c], (P < 0.01). Compared with the control group, the COL4A2 expression level in the IL-1β treatment group was down-regulated [Figure 1d], (P < 0.001). The findings demonstrate that in the epilepsy cell model, the mRNA expression levels of inflammatory factors were upregulated, whereas the expression level of COL4A2 was down-regulated.

- Expression levels of COL4A2 and inflammatory factors in epileptic cell models. (a-c) IL-6, TNF-α, and IL-1β levels in IL-1β-treated CTX-TNA cells. (d) COL4A2 level in IL-1β-treated CTX-TNA cells. n = 3, ✶✶P < 0.01, ✶✶✶P < 0.001. IL: Interleukin, TNF-α: Tumor necrosis factor α, COL4A2: Collagen type IV alpha 2.
Apoptosis rate and expression level of JAK/STAT signaling in the epileptic cell model
The anti-apoptosis ability of CTX-TNA cells decreased significantly after IL-1β treatment (P < 0.001), [Figure 2a and b]. Figures 2c and d show that the phosphorylation levels of JAK and STAT3 in CTX-TNA cells were significantly increased after IL-1β treatment (P < 0.001). In the epileptic cell model, the apoptosis rate and phosphorylation levels of JAK2 and STAT3 were significantly increased.

- Apoptosis rate and expression level of JAK/STAT signaling in the epileptic cell model. (a and b) The apoptosis rate of CTX-TNA cells was analyzed by TUNEL staining after IL-1β treatment. Scale bar=100 μm. Objective: 200×. (c and d) Phosphorylated JAK and STAT3 protein levels in IL-1β-treated CTX-TNA cells. n = 3, ✶✶✶P < 0.001. TUNEL: Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling, DAPI: 4’,6-diamidino-2-phenylindole, JAK: Janus kinase, STAT3: Signal transducer and activator of transcription 3, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, IL: Interleukin.
Effects of OGDHL overexpression on the expression levels of inflammatory cytokines and COL4A2
The overexpression efficiency of OGDHL was verified at the RNA and molecular levels [Figure 3a-c]. After its overexpression, the expression level of OGDHL increased significantly (P < 0.001). The mRNA levels of IL-1β, IL-6, and TNF-α did not significantly differ between the IL-1β and IL-1β+NC treatment groups [Figure 3d-f], which implies a successful plasmid assembly. However, the expression level of the IL-1β+OGDHL treatment group was significantly decreased (P < 0.01), which indicates that OGDHL overexpression inhibited inflammation in the epilepsy cell model. In the COL4A2 assay, the expression level of IL-1β+OGDHL group was significantly increased (P < 0.01), [Figure 3g].

- Effects of OGDHL overexpression on the expression levels of inflammatory cytokines and COL4A2. (a) mRNA expression level of OGDHL after its overexpression in CTX-TNA cells. (b and c) Protein expression level of OGDHL after its overexpression in IL-1β-treated CTX-TNA cells. (d-f) IL-6, TNF-α, and IL-1β levels after OGDHL overexpression in IL-1β-treated CTX-TNA cells. (g) COL4A2 level after OGDHL overexpression in IL-1β-treated CTX-TNA cells. n = 3, ns, no significant difference, ✶✶P < 0.01, ✶✶✶P < 0.001.OGDHL: Oxoglutarate dehydrogenase-like, IL: Interleukin, TNF-α: Tumor necrosis factor-α, mRNA: Messenger RNA.
Effects of OGDHL overexpression on apoptosis and the JAK/STAT signaling pathway
Figures 4a and b show the anti-apoptotic ability of CTX-TNA cells after different treatments. The anti-apoptosis ability of CTX-TNA cells was significantly decreased after IL-1β treatment (P < 0.001). No significant difference was observed in the apoptosis rates between the IL-1β+NC and IL-1β treatment groups. However, the anti-apoptosis ability of CTXTNA cells was significantly restored after the overexpression of ODGHL (P < 0.001). Figures 4c and d display the JAK2 and STAT3 phosphorylation levels. The phosphorylation levels of p-JAK2 and p-STAT3 proteins in the IL-1β treatment group were significantly increased (P < 0.001), and those of p-JAK2 and P-STAT3 proteins in the IL-1β+OGDHL treatment group were significantly decreased (P < 0.001). As shown in Figure 4e, CCK-8 analysis results reveal that the viability of IL-1β-treated cells increased significantly after OGDHL overexpression (P < 0.001). Increased GFAP expression levels are the first step in astrocyte hypertrophy in patients with epilepsy. As shown in Figure 4f-g, the expression level of GFAP protein was significantly increased after IL-1β treatment (P < 0.001) but significantly decreased in the IL-1β+OGDHL treatment group (P < 0.001). GFAP expression did not significantly change between the IL-1β and IL-1β+NC treatment groups. The findings demonstrate that GFAP expression was markedly elevated in the epilepsy cell model. Meanwhile, GFAP expression and cell hypertrophy were reduced by the overexpression of OGDHL.

- Effects of OGDHL overexpression on apoptosis and JAK/STAT signaling pathway. (a and b) The apoptosis rate of CTX-TNA cells was analyzed by TUNEL staining. Scale bar= 100 µm. Objective: 200×. (c and d) Phosphorylated JAK and STAT3 protein levels after OGDHL overexpression in IL-1β-treated CTX-TNA cells. (e) Cell activity after OGDHL overexpression. (f-g) GFAP protein level after ODGHL overexpression in IL-1β-treated CTX-TNA cells. n = 3, ✶✶✶P < 0.001. OGDHL: Oxoglutarate dehydrogenase-like, JAK: Janus kinase, STAT3: Signal transducer and activator of transcription 3, IL: Interleukin, GFAP: Glial fibrillary acidic protein.
Effect of OGDHL overexpression on GFAP expression level
As displayed in Figure 5a-c, PCR and WB were used to verify the efficiency of silencing OGDHL and overexpressing COL4A2. The results indicate that the expression of OGDHL decreased significantly after its silencing, and that of COL4A2 was not significantly different (P < 0.001). Their association with the JAK/STAT pathway was further demonstrated by silencing OGDHL and overexpressing COL4A2. As shown in Figure 5d, after OGDHL silencing and COL4A2 overexpression, the mRNA levels of JAK2 and STAT3 decreased significantly (P < 0.001). GFAP was stained through immunofluorescence, and the results show that its fluorescence intensity increased significantly after OGDHL silencing and decreased significantly after COL4A2 overexpression [Figure 5e and f] (P < 0.001). Figures 5g-i illustrate that the silencing of OGDHL and overexpression of COL4A2 inhibited IL-1β-induced apoptosis and promoted IL-1β-induced cell proliferation (P < 0.001). Finally, the cell viability measured through CCK-8 assay [Figure 5j] showed that the cell viability increased significantly after OGDHL silencing and COL4A2 overexpression (P < 0.001).

- Effect of OGDHL overexpression on GFAP expression level. (a-c) Efficiencies pf OGDHL silencing and COL4A2 overexpression verified at the mRNA and molecular levels. (d) mRNA levels of JAK2 and STAT3 after COL4A2 overexpression and OGDHL silencing. (e and f) Quantitative analysis and representative images of GFAP immunofluorescence staining. Scale bar=50 µm. Objective: ×400. (g-i) TUNEL and EdU-positive cells after COL4A2 overexpression and OGDHL silencing. Scale bar=100 µm. Objective: ×200. (j) Cell viability after OGDHL and COL4A2 silencing. n = 3, ns, no significant difference, ✶P < 0.05, ✶✶✶P < 0.001. OGDHL: Oxoglutarate dehydrogenase-like, COL4A2: Collagen type IV alpha 2, JAK: Janus kinase, STAT3: Signal transducer and activator of transcription 3, GFAP: Glial fibrillary acidic protein, EdU: 5-ethynyl-2’-deoxyuridine, TUNEL: Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling, mRNA: Messenger RNA.
Effect of JAK/STAT signaling pathway agonist α7nAchR on OGDHL overexpression
We discussed the effect of OGDHL overexpression combined with JAK/STAT pathway agonist α7nAchR on IL-1β-induced epilepsy cell model. Figure 6a displays the experimental data obtained from the ELISA kit used to evaluate the level of COL4A2. No statistically significant difference was observed between the COL4A2 expression levels in the IL-1β+OGDHL and IL-1β+OGDHL+α7nAchR treatment groups. However, the expression level of COL4A2 in the IL-1β+OGDHL treatment group was considerably higher than that in the IL-1β+NC treatment group (P < 0.001). We determined the effect of OGDHL overexpression combined with α7nAchR on the expression level of GFAP. As shown in Figure 6b and c, the expression level of GFAP after IL-1β treatment was significantly higher than that in the control group (P < 0.001), and no significant difference was observed between the IL-1β+NC and IL-1β treatment groups. The experimental results reveal that OGDHL overexpression can alleviate cell hypertrophy, but α7nAchR intervention reduced its effect. Finally, we measured the expression level of JAK/STAT signaling pathway protein through WB [Figure 6d and e]. The phosphorylated JAK2 and STAT3 expression levels in the IL-1β treatment group were considerably higher than those in the control group (P < 0.001). The phosphorylation levels of JAK2 and STAT3 in the IL-1β treatment group were not statistically significant compared with those after NC plasmid treatment. After OGDHL overexpression, JAK2 and STAT3 phosphorylation levels were significantly reduced (P < 0.001), which suggests a reduction in the inflammatory response of epileptic cells through inhibition of the JAK/STAT signaling pathway. However, the expression levels of phosphorylated JAK2 and STAT3 increased significantly after α7nAchR treatment (P < 0.05). Figure 7 shows the influence mechanism of OGDHL.

- Effect of JAK/STAT signaling pathway agonist α7nAchR on OGDHL overexpression. (a) COL4A2 protein level in CTX-TNA cells after OGDHL overexpression and treatment with 7NACHR. (b and c) GFAP protein level in CTX-TNA cells after OGDHL overexpression and treatment with 7NACHR. (d and e) Phosphorylated JAK and STAT3 protein levels in CTX-TNA cells after OGDHL overexpression and treatment with 7NACHR. n = 3, ns, no significant difference, ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. OGDHL: Oxoglutarate dehydrogenase-like, COL4A2: Collagen type IV alpha 2, JAK: Janus kinase, STAT3: Signal transducer and activator of transcription 3, GFAP: Glial fibrillary acidic protein.

- Map showing that ODGHL upregulates COL4A2 to inhibit the JAK/STAT signaling pathway. Drawn in PowerPoint (v16.0, Microsoft, Redmond, Washington, USA). IL: Interleukin, TNF-α: Tumor necrosis factor-α, COL4A2: Collagen type IV alpha 2, JAK2: Janus Kinase 2, STAT3: Signal transducer and activator of transcription 3, OGDHL: Oxoglutarate dehydrogenase-like.
DISCUSSION
A frequent nervous system ailment, epilepsy is a paroxysm of brain malfunction brought about by aberrant synchronous neuronal discharge, which can result in varying degrees of brain damage.[23] Abnormal expression of the OGDHL gene can cause epilepsy or neurological disorders characterized by mitochondrial diseases.[22,24] We discussed the effect of OGDHL overexpression on IL-1β-induced epilepsy cell model to further explain the relationship between OGDHL and epilepsy and the possible mechanism. According to the experimental findings, OGDHL overexpression decreased the expressions of inflammatory factors in the model of epilepsy cells, which suggests that OGDHL inhibits the inflammation associated with epilepsy. In addition, at the molecular level, the COL4A2 level in the epilepsy cell model was significantly reduced, which is consistent with the results of previous studies.[14] The experimental results also indicate the possible role of OGDHL in inhibiting epilepsy inflammation through upregulation of the expression level of COL4A2. JAK2 and STAT3 phosphorylation levels are elevated in the hippocampus of epileptic model rats, which is consistent with our experimental results.[25] However, in the OGDHL-overexpression group, the phosphorylation levels of JAK2 and STAT3 were reduced, which further verifies that OGDHL overexpression inhibited inflammation by inhibiting the phosphorylation levels of JAK2 and STAT3. Moreover, we investigated the effect of OGDHL on CTXTNA astrocytes. Astrocyte dysfunction is a major factor in the etiology of epilepsy.[26] Astrocyte death occurs in experimental convulsive models and human epilepsy.[27] In this study, the apoptosis rate of CTX-TNA cells in the epilepsy cell model increased, and this trend was reversed after OGDHL overexpression intervention. These results suggest that OGDHL overexpression inhibited IL-1β-induced inflammation of CTX-TNA cells.
The onset of epilepsy induces increased levels of GFAP expression, which is the first step in epileptic-induced astrocyte hypertrophy.[28] The high expression of GFAP aggravated the neuroinflammatory response.[29] Chronic epilepsy induces an increase in GFAP levels.[30] In addition, GFAP expression levels are positively correlated with time in the epilepsy models. Our experiment yielded the same result. The expression level of GFAP increased in the IL-1β treatment group and decreased after OGDHL overexpression. In addition, during seizures, the increase in GFAP coincided with STAT3 activation. The immune response to GFAP is enhanced in the cytoplasm of astrocytes in epileptic patients, and the phosphorylation level of STAT3 is increased.[31] Combined with the results of GFAP and JAK/STAT signaling pathways, we discovered that such an outcome is consistent with those of previous studies. Therefore, the inhibitory effect of OGDHL on epileptic inflammation was further demonstrated, and its overexpression inhibited the phosphorylation of STAT3 while down-regulating the level of GFAP. To further verify the association between OGDHL overexpression and JAK/STAT signaling pathway, we also combined the agonist α7nAchR with OGDHL. The results show that after α7nAchR intervention, the COL4A2 level decreased, and the apoptosis rate and expression levels of GFAP and phosphorylated JAK and STAT3 increased, which suggest that α7nAchR reduced the inflammatory inhibitory effect of OGDHL overexpression on IL-1β-induced epilepsy cell models.
In this study, based on the JAK/STAT signaling pathway, the expression of epilepsy-related inflammatory factors and proteins after the COL4A2 upregulation mediated by OGDHL overexpression was detected. The levels of inflammatory factors TNF-α, IL-6, and IL-1β and the apoptosis rate were decreased. In addition, the overexpression of OGDHL upregulated GFAP and phosphorylated JAK2 and STAT3. In summary, OGDHL overexpression may mediate COL4A2 upregulation, inhibit JAK2 and STAT3 phosphorylation, and thus inhibit the IL-1β-induced inflammation of CTX-TNA epileptic cell model. By exploring the relationship among OGDHL, COL4A2, and JAK/STAT, this study proposed possible therapeutic targets and new perspectives for the treatment of epilepsy.
This study still encountered many limitations. First, only rat brain type I astrocytes, which are widely used in the study of brain diseases, were used in this work. In the follow-up research, we should use animal models and clinical samples to further prove our conjecture. Furthermore, in this study, we only discussed the phosphorylation levels of JAK2 and STAT3. We will identify other signaling pathways later on to enrich the molecular events for the treatment of epilepsy. Finally, although this work revealed that OGDHL can alleviate epileptic inflammation through the upregulation of COL4A2, the specific mechanism of this effect needs to be further studied.
SUMMARY
This study determined that OGDHL overexpression may inhibit the expressions of inflammatory factors. The use of the JAK/STAT signaling pathway agonist α7nAchR further demonstrated JAK/STAT as a downstream molecular event of OGDHL. These results suggest that OGDHL may reduce epileptic inflammation by inhibiting the JAK/STAT signaling pathway through the upregulation of COL4A2.
AVAILABILITY OF DATA AND MATERIALS
The datasets used and/or analyzed during the present study were available from the corresponding author on reasonable request.
ABBREVIATIONS
BCA: Bicinchoninic acid assay
CCK-8: Cell counting kit-8
COL4A2: Collagen type IV alpha 2
DAPI: 4’,6-diamidino-2’-phenylindole
EdU: 5-Ethynyl-2’-deoxyuridine
ELISA: Enzyme-linked immunosorbent assay
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
GFAP: Glial fibrillary acidic protein
IL: Interleukin
JAK: Janus kinase
OGDHL: Oxoglutarate dehydrogenase-like
PBS: Phosphate buffer saline
STAT: Signal transducer and activator of transcription
TBST: Tris-buffered saline with tween-20
TNF-α: Tumor necrosis factor-α
TUNEL: Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling
AUTHOR CONTRIBUTIONS
WZ.W and HC: Designed the study; all authors conducted the study; QC and TT.G: Collected and analyzed the data; QN.S and DQ.F: Participated in drafting the manuscript, and all authors contributed to critical revision of the manuscript for important intellectual content. All authors gave final approval of the version to be published. All authors participated fully in the work, took public responsibility for appropriate portions of the content, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or completeness of any part of the work were appropriately investigated and resolved. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
Ethical approval and consent to participate is not required as this study did not use clinical samples or animal experiments.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Not applicable.
References
- Perspectives on treatment options for mesial temporal lobe epilepsy with hippocampal sclerosis. Expert Opin Pharmacother. 2015;16:2355-71.
- [CrossRef] [PubMed] [Google Scholar]
- The epidemiology of epilepsy. Neuroepidemiology. 2020;54:185-91.
- [CrossRef] [PubMed] [Google Scholar]
- Past and present definitions of epileptogenesis and its biomarkers. Neurotherapeutics. 2014;11:231-41.
- [CrossRef] [PubMed] [Google Scholar]
- Seizures and epilepsy: An overview for neuroscientists. Cold Spring Harb Perspect Med. 2015;5:a022426.
- [CrossRef] [PubMed] [Google Scholar]
- The role of inflammation in the development of epilepsy. J Neuroinflammation. 2018;15:144.
- [CrossRef] [PubMed] [Google Scholar]
- COL4A2 in the tissue-specific extracellular matrix plays important role on osteogenic differentiation of periodontal ligament stem cells. Theranostics. 2019;9:4265-86.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular and genetic analyses of collagen type IV mutant mouse models of spontaneous intracerebral hemorrhage identify mechanisms for stroke prevention. Circulation. 2015;131:1555-65.
- [CrossRef] [PubMed] [Google Scholar]
- Mutations in Col4a1 cause perinatal cerebral hemorrhage and porencephaly. Science. 2005;308:1167-71.
- [CrossRef] [PubMed] [Google Scholar]
- Main features of COL4A1-COL4A2 related cerebral microangiopathies. Cereb Circ Cogn Behav. 2022;3:100140.
- [CrossRef] [PubMed] [Google Scholar]
- Recessive COL4A2 mutation leads to intellectual disability, epilepsy, and spastic cerebral palsy. Neurol Genet. 2021;7:e583.
- [CrossRef] [PubMed] [Google Scholar]
- The expanding phenotype of COL4A1 and COL4A2 mutations: Clinical data on 13 newly identified families and a review of the literature. Genet Med. 2015;17:843-53.
- [CrossRef] [PubMed] [Google Scholar]
- Genistein protects epilepsy-induced brain injury through regulating the JAK2/STAT3 and Keap1/Nrf2 signaling pathways in the developing rats. Eur J Pharmacol. 2021;912:174620.
- [CrossRef] [PubMed] [Google Scholar]
- LncRNA H19 contributes to hippocampal glial cell activation via JAK/STAT signaling in a rat model of temporal lobe epilepsy. J Neuroinflammation. 2018;15:103.
- [CrossRef] [PubMed] [Google Scholar]
- A new identified COL4A2 mutation contributes to astrocyte activation by activating JAK/STAT signaling in epilepsy. Authorea [Preprints] 2022 Available from: https://www.researchsquare.com/article/rs-3324384/v1
- [CrossRef] [Google Scholar]
- The JAKSTAT signaling pathway in epilepsy. Curr Neuropharmacol. 2023;21:2049-69.
- [CrossRef] [PubMed] [Google Scholar]
- Prognostic and immune predictive roles of a novel tricarboxylic acid cycle-based model in hepatocellular carcinoma. Sci Rep. 2024;14:2333.
- [CrossRef] [PubMed] [Google Scholar]
- Positive correlation between rat brain glutamate concentrations and mitochondrial 2-oxoglutarate dehydrogenase activity. Anal Biochem. 2018;552:100-9.
- [CrossRef] [PubMed] [Google Scholar]
- Effect of AmyTrap, an amyloid-β binding drug, on Aβ induced mitochondrial dysfunction and tau phosphorylation in cultured neuroblastoma cells. Metab Brain Dis. 2020;35:923-31.
- [CrossRef] [PubMed] [Google Scholar]
- Dihydrolipoamide dehydrogenase suppression induces human tau phosphorylation by increasing whole body glucose levels in a C. elegans model of Alzheimer's disease. Exp Brain Res. 2018;236:2857-66.
- [CrossRef] [PubMed] [Google Scholar]
- OGDHL ameliorates cognitive impairment and Alzheimer's disease-like pathology via activating Wnt/β-catenin signaling in Alzheimer's disease mice. Behav Brain Res. 2022;418:113673.
- [CrossRef] [PubMed] [Google Scholar]
- Interleukin-1β plays a role in the pathogenesis of mesial temporal lobe epilepsy through the PI3K/Akt/mTOR signaling pathway in hippocampal neurons. J Neuroimmunol. 2015;282:110-7.
- [CrossRef] [PubMed] [Google Scholar]
- Bi-allelic variants in OGDHL cause a neurodevelopmental spectrum disease featuring epilepsy, hearing loss, visual impairment, and ataxia. Am J Hum Genet. 2021;108:2368-84.
- [CrossRef] [PubMed] [Google Scholar]
- Identification of new epilepsy treatments: Issues in preclinical methodology. Epilepsia. 2012;53:571-82.
- [CrossRef] [PubMed] [Google Scholar]
- A biallelic pathogenic variant in the OGDH gene results in a neurological disorder with features of a mitochondrial disease. J Inherit Metab Dis. 2021;44:388-400.
- [CrossRef] [PubMed] [Google Scholar]
- α-linolenic acid ameliorates pentylenetetrazol-induced neuron apoptosis and neurological impairment in mice with seizures via down-regulating JAK2/STAT3 pathway. Br J Nutr. 2024;132:1-12.
- [CrossRef] [PubMed] [Google Scholar]
- Baicalin suppresses neuron autophagy and apoptosis by regulating astrocyte polarization in pentylenetetrazol-induced epileptic rats and PC12 cells. Brain Res. 2022;1774:147723.
- [CrossRef] [PubMed] [Google Scholar]
- MicroRNA-34b mediates hippocampal astrocyte apoptosis in a rat model of recurrent seizures. BMC Neurosci. 2016;17:56.
- [CrossRef] [PubMed] [Google Scholar]
- Seizures and the regulation of astroglial gene expression. Epilepsy Res Suppl. 1992;7:197-209.
- [Google Scholar]
- Arbutin attenuates cognitive impairment and inflammatory response in pentylenetetrazol-induced kindling model of epilepsy. Neuropharmacology. 2019;146:117-27.
- [CrossRef] [PubMed] [Google Scholar]
- Correlation between GAT-1 expression and astrocytes in brain tissues of rats with chronic epilepsy. Med J Na tl Defend Forces Southwest China. 2010;20:605-7.
- [Google Scholar]
- LncRNA-UCA1 inhibits the astrocyte activation in the temporal lobe epilepsy via regulating the JAK/STAT signaling pathway. J Cell Biochem. 2020;121:4261-70.
- [CrossRef] [PubMed] [Google Scholar]
