Translate this page into:
Preliminary investigation on the correlation between karyopherin alpha 4 and acute cerebral infarction
-
Received: ,
Accepted: ,
How to cite this article: Chu J, Ren N, Xie C. Preliminary investigation on the correlation between karyopherin alpha 4 and acute cerebral infarction. CytoJournal. 2025;22:64. doi: 10.25259/Cytojournal_8_2025
Abstract
Objective:
Acute cerebral infarction (ACI) has a high incidence and complex etiology, so searching for specific diagnosis and therapeutic target molecules is highly important. This paper aimed to explore the mechanism of karyopherin alpha 4 (KPNA4) in ACI.
Material and Methods:
Four groups were established: sham group, middle cerebral artery occlusion (MCAO) group, MCAO + small interfering negative control (si-NC group), and MCAO + si-KPNA4 group. The Zea-Longa scoring standard was adopted to assess the neurological impairment of ACI rats. The expression of KPNA4 was verified by real-time quantity polymerase chain reaction assay and Western blot. 2,3,5-Triphenyltetrazolium chloride and hematoxylin and eosin staining were used to examine the effects of KPNA4 knockdown on brain injury in ACI rats. The apoptosis of oxygen-glucose deprivation (OGD)-SH-SY5Y cells was measured by the terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling method. Western blot analysis was performed to analyze the expression levels of apoptosis-related proteins, inflammatory factors, and nuclear factor kappa B (NF-κB) pathway-related proteins.
Results:
KPNA4 was overexpressed in the MCAO rat brain (P < 0.0001) and OGD-SH-SY5Y cells (P < 0.0001). Knocking down KPNA4 significantly reduced the degree of brain damage (P < 0.0001) and reduced the apoptosis of OGD-SH-SY5Y cells (P < 0.001). KPNA4 knockdown also significantly decreased the expression levels of inflammatory factors (interleukin [IL]-1β, tumor necrosis factor-α, and IL-18; P < 0.0001) and prohibited the phosphorylation of the inhibitor of NF-κB and p65 (P < 0.0001). However, NF-κB agonist lipopolysaccharide reversed the inhibition of KPNA4 knockdown.
Conclusion:
In general, KPNA4 knockdown can mitigate ACI-induced damage by regulating the NF-kB pathway. This finding provides a new perspective on the treatment of ACI.
Keywords
Acute cerebral infarction
Karyopherin alpha 4
Nuclear factor kappa B pathway
INTRODUCTION
Intracranial and external artery stenosis or occlusion leads to insufficient blood supply to the brain, resulting in ischemic necrosis or cerebral softening, which is called acute cerebral infarction (ACI).[1] It has a high fatality rate and morbidity and has become the first disease that leads to the death of urban residents in China. Unfortunately, patients with ACI are gradually becoming younger, which brings huge mental pressure and economic burden to patients.[2] After cerebral infarction, cerebral blood circulation disorder often causes neuronal injury and apoptosis and leads to paralysis, aphasia, and other neurological deficits. At present, the effective treatment for ACI is intravenous thrombolysis with recombinant tissue plasminogen activator and mechanical thrombectomy,[3] but these two treatments have many contraindications.[4] Therefore, taking effective measures to inhibit and alleviate neuronal injury and apoptosis after brain injury has profound significance in promoting the recovery of nerve function in ACI.
Karyopherin alpha (KPNA) is a group of receptor proteins that mediate the shuttle movement of multiple transcription factors by binding to nuclear localization signaling molecules. The KPNA family genes have been associated with the development of malignant tumors, neurological diseases, and heart-related diseases. KPNA1 is involved in striatal response to denervation in Parkinson’s disease rat models.[5] Interference with KPNA2 expression inhibited the malignant behavior of laryngeal carcinoma cells.[6] The complex heterozygous mutations of KPNA7 have been found to be associated with human neurodevelopmental diseases.[7] One of the key members of the KPNA family, KPNA4, is an intracellular transport protein that is related to the regulatory mechanism of aging and apoptosis of lens epithelial cells.[8] KPNA4 is highly expressed in liver cancer, and its expression is positively associated with the infiltration of dendritic cells, immune cells, macrophages, and neutrophils.[9] KPNA4 has been shown to be a good prognostic marker for glioma.[10] Certain single-nucleotide polymorphisms of KPNA4 can lead to the inactivation of this gene, thereby increasing the risk of schizophrenia.[11] In addition, KPNA4 plays a role in Parkinson’s disease – a neurodegenerative disease.[12] However, the relationship between KPNA4 expression and ACI has not been clarified, and it is worth studying.
Here, a middle cerebral artery occlusion (MCAO) rat model was constructed to verify the function of KPNA4 in ACI. The effect of KPNA4 on the apoptosis and inflammatory response in SH-SY5Y cells was studied, which provided a strong theoretical basis for further research on the mechanism of KPNA4 and a direction for the study of the pathogenesis of ACI.
MATERIAL AND METHODS
ACI rat model
The SD rats (7 or 8 weeks, 200–220 g) used in this experiment were from Beijing Maide Kangna Co., Ltd. After anesthesia (1% pentobarbital sodium, 40 mg/kg, 69020100, Sigma, St. Louis, USA) was administered, the rat’s right internal carotid artery and external carotid artery were blocked by thread embolism. [13] In accordance with the Zea-Longa scoring criteria, the success of modeling was indicated when the walking features of the rats were turning, leaning left, or even unable to walk upright. A total of 45 rats were successfully modeled and randomly grouped into the MCAO group, MCAO + small interfering negative control (si-NC) group, and MCAO + si-KPNA4 group. Another 15 rats with exposed but unligated right internal carotid artery and external carotid artery were used as the sham group. The si-KPNA4 and si-NC groups were injected with adenovirus vector solutions containing si-KPNA4 and si-NC through the tail vein, respectively, at a concentration of 20 mol/L per rat. Normal saline was injected into the MCAO group and sham group, and each group was given continuous administration for 6 days, once every 3 days. The death and activity of the rats were observed during administration. Beijing Maide Kangna Laboratory Animal Welfare and Ethics Committee approved our experiment (Approval No. MDKN-2024-043).
Evaluation of neural function in rats
Neurological function was assessed using the ZeaLonga score by an investigator with no knowledge of the grouping[14] as follows: Score 4: Cannot walk freely or even lose consciousness; score 3: Lean left when walking; score 2: Turn left when walking; score 1: Left front paw cannot fully extend; and score 0: No abnormality. Rats with scores between 1 and 3 were considered successful in modeling.
2,3,5-Triphenyltetrazolium chloride (TTC) staining
The brain tissues were frozen at −20°C for 20 min after the rats were sacrificed by CO2 asphyxiation. Then, coronal brain sections with a thickness of 2 mm were cut along the coronal plane. The brain slices were immersed in 2% TTC solution (KL14291A, Kalang, Shanghai, China) and incubated at 37°C for 20 min. The sections were then fixed in the fixing solution (PN4204, G-Clone, Beijing, China) for 24 h. The cerebral infarction volume was analyzed with ImagePro Plus software (6.0, Media Cybernetics, Maryland, USA). After staining, the infarct part was white, and the infarct volume (%) = infarct volume/total volume of brain slice × 100%.
Hematoxylin and eosin (HE) staining
The rat brain tissues were fixed with a fixing solution (PN4204, G-Clone, Beijing, China) and cut into 5 mm slices after dehydration with alcohol. After HE staining (BP-DL001, Sbjbio, Nanjing, China) and mounting, the specimen was assessed by an optical microscope (ML31-M, Mshot, Guangzhou, China).
Real-time quantity polymerase chain reaction (PCR)
TRIzol (15596018CN, Invitrogen, Waltham, USA) was added to cell and brain tissue samples to extract total RNA. RNA purity and concentration were examined by NanoDrop2000 (Thermo Scientific, Waltham, USA). Reverse transcription (LM-63826, LMAl Bio, Shanghai, China) was performed, followed by PCR amplification. KPNA4 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were detected, and the relative contents were calculated by 2−ΔΔCT method. Table 1 shows the sequence of primers in the experiment.
| Gene | Primer sequences (5'-3') |
|---|---|
| KPNA4 (human) | Forward: GCACTCCTGACACATCCCAA |
| Reverse: TGCCAAAATCCCCCTTATCCA | |
| KPNA4 (rat) | Forward: GGAGGAAAGACCAAGTCGCC |
| Reverse: TCAATTTTCTCCAGTCCACCACA | |
| GAPDH (human) | Forward: TGCAACCGGGAAGGAAATGA |
| Reverse: GCCCAATACGACCAAATCAGA | |
| GAPDH (rat) | Forward: AGGGACAGTGTCTCCAATCCT |
| Reverse: GATACGGCCAAATCCGTTCA |
KPNA4: Karyopherin alpha 4, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
Cell culture and oxygen-glucose deprivation (OGD) treatment
The human neuroblastoma cells used in this study (SHSY5Y) were bought from EK-Bioscience (CC-Y1459, Shanghai, China). The SH-SY5Y cells were tested negative for mycoplasma, and the short tandem repeat identification was correct. The SH-SY5Y cell culture medium (ml-CC5557, EK-Bioscience, Shanghai, China) was used for cell culture at 37°C and 5% CO2. The injury of ACI on nerve cells was simulated by the OGD cell model.[15] SH-SY5Y cells were cultured for 24 h in a medium containing 95% N2 and 5% CO2 at 37℃ (serum-free/glucose-free).
Western blot assay
Total protein was extracted from SH-SY5Y cells or brain tissues using RIPA lysate (R21237, Yuanye, Shanghai, China). Bicinchoninic acid method was used to determine the protein concentration. After sodium dodecyl sulfate-polyacrylamide gel electrophoresis was conducted using 50 μg of protein, polyvinylidene fluoride membrane (IPVH00010, Millipore, Boston, USA) transfer was performed. The membrane reacted in a rapid sealing solution for 15 min and was incubated with primary and secondary antibodies in accordance with the routine steps. After adding chemiluminescent reagents (HS-11000001, Heliosense, Xiamen, China), the membrane was placed into the chemiluminescence imaging system (JP-K300, Jinpeng, Shanghai, China) for imaging. The gray value was assessed by Image J Fiji (National Institutes of Health, New York, USA). The primary antibodies used were anti-KPNA4 (ab302556, 1:1000, Abcam, Cambridge, MA, USA), anti-B cell lymphoma 2 (Bcl-2, ab194583, 1:1000), anti-Bcl-2 Associated X protein (Bax, ab32503, 1:1000), anti-cleaved caspase 3 (ab184787, 1:2000), anti-GAPDH (ab181602, 1:10000), anti-p65 (ab19870, 1:1000), anti-p-p65 (ab76302, 1:1000), anti-inhibitor of NF-κB (IκB) (sc-1643, 1:500, Santa Cruz Biotechnology, USA), anti-p-IκB (sc-8404, 1:500, Santa Cruz Biotechnology, USA), anti-interleukin (IL)-18 (ab191860, 1:1000), anti-IL-1β (ab283818, 1:1000), and anti-tumor necrosis factor-α (TNF-α, ab307164, 1:1000). The secondary antibody was goat anti-rabbit immunoglobulin G (ab7090, 1:10000, Abcam, Cambridge, MA, USA).
Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay
After fixation, the cells were permeabilized with 0.1% Triton X-100 (G1204, Servicebio, Wuhan, China). The cells were incubated with the TUNEL kit (C1088, Beyotime, Shanghai, China). After 4,6-diamidino-2-phenyiindole staining (BES22219KB, BIOESN, Shanghai, China) was performed for 10 min, the apoptotic cells were counted by a fluorescence microscope (IX71, Olympus, Japan).
Statistical analysis
Data were analyzed by the Statistical Package for the Social Sciences (SPSS) (24.0, SPSS Inc., IBM Corporation, Chicago, IL, USA). Independent sample t-test was used for comparison between two groups, and Tukey’s post hoc test of one-way analysis of variance was used for comparison among multiple groups. The P-value with statistical significance was <0.05.
RESULTS
KPNA4 was notably increased in rats with infarction
KPNA4 protein expression and messenger ribonucleic acid (mRNA) expression in the sham group were lower than in the MCAO group (P < 0.0001) [Figure 1a-c]. The protein (P < 0.0001) [Figure 1d and e] and mRNA (P < 0.01) [Figure 1f] expression levels of KPNA4 were successfully knocked down to further verify the role of KPNA4 in the progression of ACI. The results confirmed that abnormal expression of KPNA4 affects the degree of cerebral infarction injury.

-
KPNA4 was notably increased in rats with infarction. (a and b) KPNA4 protein expression in ACI rat brain tissue. (c) KPNA4 mRNA expression in ACI rat brain tissue. (d and e) Knockdown efficiency of KPNA4 detected by Western blot. (f) Knockdown efficiency of KPNA4 detected by RT-qPCR. n = 4, ✶✶P < 0.01, ✶✶✶✶P < 0.0001. KPNA4: Karyopherin α4, MCAO: Middle cerebral artery occlusion, ACI: Acute cerebral infarction, RT-qPCR: Real-time quantity polymerase chain reaction, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.
KPNA4 knockdown improved brain injury in ACI rats
In the sham group, the rats did not die and had normal behavior. In the model group, the rats were listless, their diet and activities decreased, the phenomenon of turning to one side while walking increased, and two rats died. The above behavioral activities of the MCAO + si-NC group rats were similar to those of the MCAO group, and one rat died. In the MCAO + si -KPNA4 group, the occurrence of sideward rotation was reduced, and two rats died. The neural function score of the MCAO group was higher than that of the sham group. The neurological function score of the MCAO + si-KPNA4 group was dramatically lower than that of the MCAO + si-NC group (P < 0.01) [Figure 2a]. In the model group, significant infarct volume was observed, and si-KPNA4 could partially recover cerebral infarction (P < 0.0001) [Figure 2b and c]. HE staining showed cytoplasmic loosening, cell necrosis, nuclear shrinkage, nucleolysis, and tissue disorder in the cerebral cortex surrounding the infarction in the MCAO and si-NC groups, and si-KPNA4 restored the tissue damage (P < 0.0001) [Figure 2d and e]. The above results indicated that knocking down KPNA4 improved brain injury in ACI rats.

-
KPNA4 knockdown improved brain injury in ACI rats. (a) Neurological function score in each group of rats. (b and c) Diagram of TTC staining for cerebral infarction. (d and e) HE staining showing brain tissue damage in rats (magnification: 200×, scale: 100 μm). n = 5, ✶✶P < 0.01; ✶✶✶✶P < 0.0001. KPNA4: Karyopherin α4, TTC: 2,3,5-triphenyltetrazolium chloride, MCAO: Middle cerebral artery occlusion, HE: Hematoxylin and eosin.
Interference of KPNA4 attenuated OGD-induced apoptosis of nerve cells
SH-SY5Y cells were selected to examine how KPNA4 affects brain damage in vitro. The KPNA4 protein (P < 0.0001) and mRNA (P < 0.001) expression levels were successfully knocked down in OGD- SH-SY5Y cells [Figure 3a-c]. The expression of Bax (P < 0.0001) and cleaved caspase 3 (P < 0.0001) decreased clearly after KPNA4 knockdown, whereas Bcl-2 expression (P < 0.05) increased significantly [Figure 4a-d]. Similarly, the TUNEL results confirmed that the apoptosis rate of cells transfected with KPNA4 interference was lower than that of cells transfected with OGD + si-NC (P < 0.001) [Figure 4e and f]. The findings demonstrated that KPNA4 downregulation alleviated the apoptosis of brain nerve cells.

- Expression of KPNA4 in OGD- SH-SY5Y cells. (a and b) KPNA4 protein expression in OGD- SH-SY5Y cells. (c) KPNA4 mRNA expression in OGD- SH-SY5Y cells. n = 3, ✶✶✶P < 0.001, ✶✶✶✶P < 0.0001. KPNA4: Karyopherin α4, OGD: Oxygen glucose deprivation, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

- Interference of KPNA4-attenuated OGD-induced apoptosis of nerve cells. (a-d) Expression of apoptosis-associated proteins. (e and f) Apoptosis of hippocampal neurons, measured by TUNEL (magnification: 200×, scale: 100 μm). n = 3, ✶P < 0.05, ✶✶✶P < 0.001, ✶✶✶✶P < 0.0001. KPNA4: Karyopherin α4, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, OGD: Oxygen glucose deprivation, Bcl-2: B cell lymphoma 2, Bax: Bcl-2 Associated X protein, DAPI: 4,6-diamidino-2-phenyiindole, TUNEL: Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling.
KPNA4 knockdown inhibited inflammatory response in vitro
The effects of KPNA4 on inflammatory factors were detected by Western blot. The levels of proinflammatory cytokine proteins (TNF-α, IL-18, and IL-1β) in the OGD group increased, and the KPNA4 siRNA-transfected group rescued the increase caused by OGD (P < 0.0001) [Figure 5a-d]. Therefore, KPNA4 knockdown was hypothesized to inhibit the inflammatory response during ACI.

-
KPNA4 knockdown inhibited inflammatory response in vitro. (a-d) Western blot confirmation of the expression of IL-1β, TNF-α, and IL-18. n = 3, ✶✶✶P < 0.001, ✶✶✶✶P < 0.0001. KPNA4: Karyopherin α4, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, IL-1β, Interleukin-1β, OGD: Oxygen glucose deprivation, TNF-α: Tumor necrosis factor-α, IL-18: Interleukin-18.
KPNA4 regulated brain damage through the mediation of the nuclear factor kappa B (NF-κB) pathway
The phosphorylation levels of p65 and IκB clearly increased in the OGD group, and they decreased after interference with KPNA4 expression (P < 0.0001) [Figure 6a-c]. The NF-κB activator lipopolysaccharide neutralized the blocking effect of KPNA4 knockdown on p-IκB/IκB (P < 0.01) and p-p65/p65 (P < 0.05) [Figure 6d-f]. Therefore, KPNA4 may regulate ACI brain injury through the regulation of the NF-κB pathway.

-
KPNA4 regulated brain damage via the mediation of NF-κB pathway. (a-c) Western blot verification of the function of KPNA4 knockdown on NF-κB pathway. (d-f) Western blot verification of the effects of NF-κB activator LPS and KPNA4 knockdown on NF-κB pathway. n = 3, ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001, ✶✶✶✶P < 0.0001. KPNA4: Karyopherin α4, OGD: Oxygen glucose deprivation, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, NF-κB: Nuclear factor kappa B, LPS: Lipopolysaccharide, IκB: Inhibitor of NF-κB.
DISCUSSION
ACI can cause neuronal injury and apoptosis, resulting in hemiplegia, impaired consciousness, aphasia, and other neurological impairment symptoms.[16,17] The pathological processes involved in ACI are complex, including increased blood-brain barrier permeability, mitochondrial dysfunction, excitatory damage, inflammatory infiltration, edema, oxidative damage, cell apoptosis, pyrodeath, iron death, and necrosis. Here, the mechanism of KPNA4 on ACI was analyzed using various biotechnological methods such as Western blot, TUNEL, and TTC. Our results indicated that interfering with KPNA4 may be a possible therapeutic strategy for ACI.
KPNA4 is a member of the nuclear transporter family and has a transport role in mediating cellular components. The TTC staining results showed that knocking down KPNA4 reduced the degree of brain injury in rats. Next, the mechanism of KPNA4 was investigated in OGD cell models. Similarly, the in vitro experiments confirmed that knocking down KPNA4 alleviated apoptosis in OGD-SH-SY5Y cells. Analogously, miR-24 inhibited the malignant progression of endothelial cells by prohibiting the expression of KPNA4, suggesting that KPNA4 may play a role in atherosclerosis.[18] In glioma, the most common tumor of the brain, KPNA4 promoted epithelial-mesenchymal transformation of glioma cells.[19] In addition, KPNA4 knockdown mitigated cell apoptosis, cytotoxicity, and inflammation in Parkinson’s disease.[20]
Therefore, KPNA4 may play a specific role in the progression of ACI and other brain injury diseases. Inflammation is an important pathological mechanism of ACI.[21] After cerebral ischemia and hypoxia, inflammatory factors and mediators are the pathological basis for the occurrence of ischemic injury to inflammatory injury.[22]
Inflammatory factors can activate white blood cells to adhere to the microvascular endothelium in the ischemic area, leading to the atrophy and necrosis of endothelial cells and aggravating the injury in the cerebral ischemia-reperfusion area.[23] Here, PKNA4 knockdown reduced the levels of IL-1β, TNF-α, and IL-18. A similar effect of KPNA4 exists in the tumor microenvironment, where KPNA4 accelerates prostate cancer progression by enhancing inflammatory responses such as TNF-α and TNF-β.[24] In addition, KPNA4 promoted the apoptosis of SK-N-SH cells induced by 1-methyl-4-phenylpyridinium (MPP+); inhibited cell proliferation; decreased reactive oxygen species level; and increased TNF-α, malondialdehyde, and IL-6.[12] Therefore, we concluded that interfering with KPNA4 expression suppressed the inflammatory response in ACI.
A previous study indicated the importance of the NF-κB pathway in the pathogenesis of cerebral infarction.[25] As an important redox-sensitive transcription factor, NF-κB can induce multiple pro-inflammatory genes and regulate inflammatory factors such as TNF-α and IL-1β. The NF-κB pathway and its downstream inflammatory factors can participate in the inflammatory response after brain injury, and inhibition of this inflammatory pathway may be the key to neuroprotection.[26] KPNA4 accelerated the development of papillary thyroid cancer through the activation of the NF-κB pathway.[27] MiR-181b overexpression hindered the expression of KPNA4 (importin-α3) in ECs and suppressed the NF-κB pathway.[28] Here, the expression of KPNA4 was interfered, the phosphorylation levels of p65 and IκB were considerable reduced, and the NF-κB activator reversed the effect of KPNA4 knockdown. Likewise, in SK-N-SH cells treated with MPP+, KPNA4 overexpression neutralized the decrease in the phosphorylation levels of p65 and IκBα induced by berberine.[29] In summary, we concluded that KPNA4 may modulate ACI brain injury through the NF-κB pathway.
However, the sample size of the study’s in vivo experiments was small, which may limit the statistical power and generalizability of the findings. Further experiments are needed to elucidate the mechanism between KPNA4 and the NF-κB pathway. In addition, this study focused on acute outcomes after KPNA4 knockdown, and long-term functional outcomes, such as recovery of motor and cognitive function, could be considered in the future.
SUMMARY
KPNA4 knockdown can ameliorate ACI-induced brain tissue injury to a certain extent, possibly by participating in the regulation of NF-κB pathway. Knocking down KPNA4 may be a potential therapeutic strategy for ACI.
AVAILABILITY OF DATA AND MATERIALS
The data that support the findings of this study are available from the corresponding author upon reasonable request.
ABBREVIATIONS
ACI: Acute cerebral infarction
Bax: Bcl-2 Associated X protein
Bcl-2: B cell lymphoma 2
DAPI: 4,6-diamidino-2-phenyiindole
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
HE: Hematoxylin and eosin
IL-18: Interleukin-18
IL-1β: Interleukin-1β
IκB: Inhibitor of NF-κB
KPNA4: Karyopherin α4
LPS: Lipopolysaccharide
MCAO: Middle cerebral artery occlusion
NF-κB: Nuclear factor kappa B
OGD: Oxygen glucose deprivation
RT-qPCR: Real-time quantity polymerase chain reaction
TNF-α: Tumor necrosis factor-α
TTC: 2,3,5-triphenyltetrazolium chloride
TUNEL: Terminal deoxynucleotidyl transferase-mediated
dUTP nick end labeling
AUTHOR CONTRIBUTIONS
JZ.C and NN.R: Conducted the research and contributed to data analysis and interpretation of the results; CL.X: Provided assistance and suggestions for the experiments. All authors participated in the drafting and critical revision of the manuscript. All authors have read and approved the final manuscript. All authors were fully involved in the work, able to take public responsibility for relevant portions of the content and agreed to be accountable for all aspects of the work, ensuring that any questions related to its accuracy or integrity are addressed. All authors have ICMJE authorship eligibility criteria.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
This study was approved by Beijing Maide Kangna Laboratory Animal Welfare Ethics Committee, approval No. MDKN-2024-043. Informed consent to participate is not required, as this study does not involve human subjects.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Not applicable.
References
- Correlation analysis of trial of org 10172 in acute stroke treatment classification and national institutes of health stroke scale score in acute cerebral infarction with risk factors. Rev Assoc Med Bras (1992). 2022;68:44-9.
- [CrossRef] [PubMed] [Google Scholar]
- Prevention and treatment of stroke in Chinese and African young adults. Zhonghua Yu Fang Yi Xue Za Zhi. 2022;56:1142-9.
- [Google Scholar]
- Efficacy of mechanical thrombectomy in stroke patients with large vessel involvement. Eur J Transl Myol. 2022;32:10456.
- [CrossRef] [PubMed] [Google Scholar]
- Management of large vessel occlusion stroke related to infective endocarditis: Is mechanical thrombectomy a safe option? J Stroke Cerebrovasc Dis. 2020;29:105248.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular cloning and characterization of rat karyopherin alpha 1 gene: Structure and expression. Gene. 2004;331:149-57.
- [CrossRef] [Google Scholar]
- Silencing KPNA2 promotes ferroptosis in laryngeal cancer by activating the FoxO signaling pathway. Biochem Genet. 2024;62:4867-83.
- [CrossRef] [PubMed] [Google Scholar]
- An epilepsy-associated mutation in the nuclear import receptor KPNA7 reduces nuclear localization signal binding. Sci Rep. 2020;10:4844.
- [CrossRef] [PubMed] [Google Scholar]
- KPNA4 is involved in cataract formation via the nuclear import of p53. Gene. 2021;786:145621.
- [CrossRef] [PubMed] [Google Scholar]
- Value of KPNA4 as a diagnostic and prognostic biomarker for hepatocellular carcinoma. Aging (Albany NY). 2021;13:5263-83.
- [CrossRef] [PubMed] [Google Scholar]
- Identification of a circRNA-miRNA-mRNA regulatory network for exploring novel therapeutic options for glioma. PeerJ. 2021;9:e11894.
- [CrossRef] [PubMed] [Google Scholar]
- Convergent findings for abnormalities of the NF-κB signaling pathway in schizophrenia. Neuropsychopharmacology. 2013;38:533-9.
- [CrossRef] [PubMed] [Google Scholar]
- Long non-coding RNA UCA1 regulates MPP+-induced neuronal damage through the miR-671-5p/KPNA4 pathway in SK-N-SH cells. Metab Brain Dis. 2023;38:961-72.
- [CrossRef] [PubMed] [Google Scholar]
- Neuroprotective effect of astragaloside IV on cerebral ischemia/reperfusion injury rats through sirt1/mapt pathway. Front Pharmacol. 2021;12:639898.
- [CrossRef] [PubMed] [Google Scholar]
- Crosstalk between ferroptosis and necroptosis in cerebral ischemia/reperfusion injury and Naotaifang formula exerts neuroprotective effect via HSP90-GCN2-ATF4 pathway. Phytomedicine. 2024;130:155399.
- [CrossRef] [PubMed] [Google Scholar]
- ChemR23 signaling ameliorates brain injury via inhibiting NLRP3 inflammasome-mediated neuronal pyroptosis in ischemic stroke. J Transl Med. 2024;22:23.
- [CrossRef] [PubMed] [Google Scholar]
- Impact of cerebral microbleeds on cognitive functions and its risk factors in acute cerebral infarction patients. Neurol Res. 2023;45:564-71.
- [CrossRef] [Google Scholar]
- Hypoxemia found after hospitalization with right hemiplegia due to cerebral infarction: Platypnea-orthodeoxia syndrome in the older people. J Cardiol Cases. 2022;25:72-5.
- [CrossRef] [PubMed] [Google Scholar]
- MicroRNA-24 inhibits the proliferation and migration of endothelial cells in patients with atherosclerosis by targeting importin-α3 and regulating inflammatory responses. Exp Ther Med. 2018;15:338-44.
- [CrossRef] [Google Scholar]
- Upregulation of miR-181s reverses mesenchymal transition by targeting KPNA4 in glioblastoma. Sci Rep. 2015;5:13072.
- [CrossRef] [PubMed] [Google Scholar]
- Long noncoding RNA SNHG14 knockdown exerts a neuroprotective role in MPP+-induced Parkinson's disease cell model through mediating miR-135b-5p/KPNA4 axis. Metab Brain Dis. 2022;37:2363-73.
- [CrossRef] [PubMed] [Google Scholar]
- Prognostic value of inflammatory markers for all-cause mortality in patients with acute myocardial infarction in the coronary care unit: A retrospective study based on MIMIC-IV database. Front Cardiovasc Med. 2025;12:1439650.
- [CrossRef] [PubMed] [Google Scholar]
- α7-nicotinic acetylcholine receptor activation modulates BV2 microglial plasticity via miR-21/TNF-α/NFκB in oxygen-glucose deprivation/reoxygenation. J Mol Neurosci. 2024;75:2.
- [CrossRef] [PubMed] [Google Scholar]
- miR-98 reduces endothelial dysfunction by protecting blood-brain barrier (BBB) and improves neurological outcomes in mouse ischemia/reperfusion stroke model. J Cereb Blood Flow Metab. 2019;40:1953-65.
- [CrossRef] [PubMed] [Google Scholar]
- Inhibition of KPNA4 attenuates prostate cancer metastasis. Oncogene. 2017;36:2868-78.
- [CrossRef] [PubMed] [Google Scholar]
- Protective effect and mechanism of Lactobacillus on cerebral ischemia reperfusion injury in rats. Braz J Med Biol Res. 2018;51:e7172.
- [CrossRef] [PubMed] [Google Scholar]
- Long non-coding RNA ANRIL downregulation alleviates neuroinflammation in an ischemia stroke model via modulation of the miR-671-5p/NF-κB pathway. Neurochem Res. 2022;47:2002-15.
- [CrossRef] [PubMed] [Google Scholar]
- KPNA4 regulated by miR-548b-3p promotes the malignant phenotypes of papillary thyroid cancer. Life Sci. 2021;265:118743.
- [CrossRef] [PubMed] [Google Scholar]
- MicroRNA-181b regulates NF-κB-mediated vascular inflammation. J Clin Invest. 2012;122:1973-90.
- [CrossRef] [PubMed] [Google Scholar]
- Berberine attenuates MPP+-induced neuronal injury by regulating LINC00943/miR-142-5p/KPNA4/NF-κB pathway in SK-N-SH cells. Neurochem Res. 2021;46:3286-300.
- [CrossRef] [PubMed] [Google Scholar]

