Translate this page into:
Regulator of chromosome condensation 1 and broad-complex, tramtrack and bric a brac domain-containing protein is involved in ovarian cancer growth and drug resistance
-
Received: ,
Accepted: ,
How to cite this article: Zhao G, Xiao X, Song L, Qi B. Regulator of chromosome condensation 1 and broad-complex, tramtrack and bric a brac domain-containing protein is involved in ovarian cancer growth and drug resistance. CytoJournal. 2025;22:71. doi: 10.25259/ Cytojournal_268_2024
Abstract
Objective:
Ovarian cancer (OC) is the most common and deadliest cancer in women worldwide. The high incidence and mortality rates highlight the serious threat that OC poses to women’s health. Regulator of chromosome condensation (RCC1) and broad-complex, tramtrack and bric a brac ( BTB) domain-containing protein 1 (RCBTB1), which includes the RCC1 and BTB domains, is a cell proliferation-related protein. This study aims to reveal the role of RCBTB1 in OC and its possible pathway.
Material and Methods:
The expression of RCBTB1 in OC cells was measured by quantitative real-time polymerase chain reaction (qRT-PCR) and immunohistochemistry (IHC). Transwell assay, wound-healing assay, clone formation assay, IHC, immunofluorescence, and methylthiazolyldiphenyl-tetrazolium bromide assay were used to evaluate the effect of silencing RCBTB1 in vivo and in vitro. The neurofibromin 1 (NF1)/rat sarcoma (Ras) signal axis was determined by Western Blot, qRT-PCR, and immunofluorescence.
Results:
The A2780 cells had increased RCBTB1 expression (P < 0.01). By suppressing Ras signaling, RCBTB1 silencing hindered the proliferation of OC cells with Kirsten rat sarcoma viral oncogene (KRAS) mutations. RCBTB1 activated protein kinase kinase Cε, which degrades NF1. RCBTB1 also plays a key role in the Ras/ extracellular regulated protein kinase (ERK) signal axis by inhibiting Ras GTPase. RCBTB1 knockdown may alleviate mitogen-activated protein kinase kinase ( MEK) inhibitor resistance in KRAS-mutated OC by inhibiting Ras/ERK signaling.
Conclusion:
RCBTB1 may regulate the NF1/Ras signaling axis, which is critical for OC and MEK inhibitor resistance. This research offers a unique therapeutic approach for ovaries with KRAS mutations and uncovers a previously unknown connection between RCBTB1 and NF1/Ras signaling.
Keywords
Kirsten rat sarcoma viral oncogene mutations
Neurofibromin 1/rat sarcoma signaling axis
Ovarian cancer
Regulator of chromosome condensation 1 and BTB domain-containing protein 1
INTRODUCTION
Ovarian cancer (OC) is one of the deadliest gynecological malignancies, characterized by low survival and poor prognosis.[1] The high mortality rate of OC may be secondary to non-specific clinical symptoms of the disease and the lack of preventive screening methods, leading to delayed diagnosis.[2] As a result, most patients diagnosed with OC are at the advanced stage. Risk factors for OC include family history, reproductive history, obesity, and hormones, among which the most important and dangerous factor is advanced age, which is most common in postmenopausal women.[3-5] OC often presents subtle and non-specific symptoms in its early stages because it is characterized by abnormal growth of cells in the ovaries, thus making early detection a huge challenge.[1] In addition, OC has multiple gene mutations. So far, mutations in major genes, such as TP53, PIK3CA, BRCA1/2, and Kirsten rat sarcoma viral oncogene (KRAS), have been highly associated with the occurrence of OC,[6] resulting in oncogene activity and epigenetic inactivation, aberrant DNA repair pathways in tumor cells, and compromised tumor inhibition at the end.[7] Among them, KRAS mutation is the most common.[8]
Rat sarcoma (Ras) is a cell signaling protein that is upstream of numerous signaling pathways linked to cancer and downstream of several receptor tyrosine kinases.[9] When Ras is overactive, it can trigger and coordinate various proliferative signaling pathways, which can lead to tumor growth, apoptosis, invasion, and angiogenesis in tumor cells.[10,11] Abnormal Ras signal transduction is caused by various mutations associated with closely related Ras proteins, with KRAS mutations occurring most commonly, followed by Harvey rat sarcoma viral oncogene homolog ( HRAS) and neuraminidase (NRAS).[12] These mutations affect Ras’s GTPase function, preventing GTPase activating proteins from promoting guanosine triphosphate (GTP) hydrolysis on Ras, which causes Ras to accumulate in the active form of GTP binding.[12] Previous reports have shown that Ras is the third most commonly mutated gene, and KRAS mutations are common in patients with clear cell carcinoma.[13,14] A comprehensive study demonstrated that mutations in ovarian tumors often occur on the codon of KRAS.[15] Rab23, a member of the Ras subfamily, is thought to be a viable therapeutic target for OC because it is abundantly expressed in OC tissues and contributes remarkably to the malignant features of OC.[16]
Regulator of chromosome condensation 1 and broad-complex, tramtrack and bric a brac domain-containing protein 1 (RCBTB1) encodes a protein with an N-terminal regulator of chromosome condensation 1 (RCC1) domain and a C-terminal broad-complex, tramtrack and bric a brac ( BTB) domain.[17] The RCC1 domain plays the role of small G protein Ras-related nucleoprotein guanine exchange factor, while the BTB domain is related to protein interaction.[18] RCBTB1, located on chromosome 13q14, encodes RCBTB1. Mutations in this gene are linked to inherited retinal disorders and congenital anomalies of the retinal vascular system.[19] Studies have shown that RCBTB1 stimulates the mitosis of leiomyosarcoma cells and the proliferation of liposarcoma cells in vitro, manifested by oncogene effects that promote cell proliferation.[20] RCBTB1 was discovered to be a potential miR-21-3p target in OC cells resistant to cisplatin.[21] Few studies have reported on the role and mechanism of RCBTB1 in OC. Therefore, the present study explored the role and possible pathway of RCBTB1 in OC through OC tissues through in vivo and in vitro tests to provide a new theoretical basis for the treatment strategy of OC.
MATERIAL AND METHODS
Cell culture and transfection
A2780 cells (BFN60805269, ATCC, Manassas, VA, USA) and IOSE-80 (JSY-CC1715, JSCAll, Shanghai, China) were cultured in RPMI-1640 medium (12633020, Gibco, Life Technologies, Rockville, MD, USA) supplemented with 10% fetal bovine serum (FBS, S9020, Solarbio, Beijing, China) and streptomycin–penicillin (60162ES76. Yeasen, Shanghai, China). The culture condition was 37°C at 5% carbon dioxide (CO2). A2780 cells were mycoplasma-free and STR analysis revealed that they were derived from its parental cells.
The cells were transfected with RCBTB1-interfering lentivirus (RCBTB1 shRNA (shRNA), CCGGGCCAAATTACA AGTGGGTGAACTCGAGTTCACCCACTTGTAAT TTGGCTTTTTTG), and negative control lentivirus (shNC). The lentivirus was provided by Thermo Fisher Scientific (Waltham, MA, USA). First, 1 × 105 cells were inoculated in 24-well plates of 500 uL medium and then cultured overnight at 37°C with 5% CO2. When the cell density was 50–60%, the cells were transfected with Lipofectamine 2000 (11668027, Thermo Fisher Scientific, Waltham, MA, USA), and fresh medium was replaced 24 h later. The cells were screened with purinomycin (ST551, Beyotime Biotechnology, Shanghai, China) at about 74 h after transfection. The cells were grouped as follows: NC: negative control; sh-NC: negative control to RCBTB1 shRNA, sh-RCBTB1, and RCBTB1 shRNA; shRCBTB1 + AZD6244: RCBTB1 shRNA + 1.0 μM AZD6244; sh-RCBTB1 + Epsilon-V1-2 ( EV1-2): RCBTB1 shRNA + 1.0 μM EV1-2; and NC + EV1-2: negative control + 1.0 μM EV1-2. EV1-2 (53410ES08) and AZD6244 (52008ES50) were obtained from Yeasen (Shanghai, China).
Animal
Forty-eight 4-week-old female Balb/c nude mice (10–15 g, Beijing Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into two groups, with six mice in each group. The mice were raised in a pathogen-free environment and fed and drank freely. Lentivirus-infected A2780 cells with negative control shRNA (control) or sh-RCBTB1 were injected subcutaneously into the dorsal side of mice. The volume of the tumor was measured periodically (calculation formula: V = ab2/2, where a is the long axis and b is the short axis). All mice were killed through neck dislocation at the end. All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Harbin Zhongke Saiens Biotechnology Co., Ltd. The study was approved by the Institutional Animal Care and Use Committee of Harbin Zhongke Saiens Biotechnology Co., Ltd (HRBSCIEC20230301).
Colony-formation assay
Six-well plates were inoculated with 1 × 103 cells per well and cultured for 1 week. The cells were fixed with 4% paraformaldehyde (P0099, Beyotime Biotechnology, Shanghai, China) for 30 min after being once again cleaned with phosphate buffer saline (PBS, C0221A, Beyotime Biotechnology, Shanghai, China). The cells were stained with 0.5% crystal violet (BL2247A, Biosharp, Hefei, Anhui, China) for 20 min.
Transwell assay
A 24-hole plate with an aperture of 8 μm was adopted. 1 × 105 cells were placed in the upper cavity and the lower cavity medium contained 15% FBS. For Transwell invasion, Matrigel (G8061, Solarbio, Beijing, China) was added to the upper cavity and incubated at 37°C for 30 min to solidify the Matrigel. Then cells were incubated at 37°C for 48 h, and the excess cells from the top of the filter were removed with a cotton swab. Then, the cells were fixed with 4% paraformaldehyde for 20 min and stained with crystal violet for 10 min. The excess stain was washed off with PBS. The number of cells at the bottom of the insert was counted under a microscope (CX71, Olympus, Tokyo, Japan).
Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay
A 96-well plate was used to inoculate 1 × 104 cells. Then, 5 mg/mL MTT (40206ES80, Yeasen, Shanghai, China) was added at 37°C for 4 h. After 100 μL/well MTT termination solution was added, the absorbance was measured at 570 nm by a microplate reader (Multiskan SkyHigh, Thermo Fisher Scientific, Waltham, MA, USA).
Wound-healing assay
A2780 cells were inoculated in six-well plates and cultured for 24 h. When the degree of cell confluence reached 95-100%, the cells were cut vertically with a sterile 200 μL pipe tip. The shed cells were grown for 48 h in 2 mL of serum-free media after being cleaned with PBS.
Ras GST-RBD pulldown assay
The Ras abundances of active GTP binding form were analyzed using a Ras pulldown kit (16117, Thermo Fisher Scientific, Waltham, MA, USA). The cell lysate of 1.0 mg protein was incubated with 50 μL Raf1-RBD agarose beads, and the spark of GTP binding Ras was pulled off. The assay buffer was rinsed three times, and the 2× reducing sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) sample buffer was re-suspended. Following boiling and centrifugation, the supernatant was subjected to Western blot analysis using a polyclonal antibody specific to KRAS.
Histological examination and immunohistochemistry (IHC)
OC and normal tissues were embedded in paraffin wax, and the section was 4 μm. The paraffin sections were dewaxed and rehydrated. The OC and normal tissues were stained with hematoxylin and eosin. For IHC, citrate buffer (P0081, Beyotime Biotechnology, Shanghai, China) extracts antigens from tissues. The sections were treated with 3% hydrogen peroxide and incubated with blocked buffer for 1 h. Sections were incubated with RCBTB1 primary antibody (1:2000, PA5-99183, Thermo Fisher Scientific, Waltham, MA, USA). The second antibody (31460, Thermo Fisher Scientific, Waltham, MA, USA) was then incubated. 3,3'-Diaminobenzidine dyeing solution (P0203, Beyotime Biotechnology, Shanghai, China) was added, and the sections were washed with distilled water one or two times to stop the dyeing. The stained sections were analyzed using a microscope.
Immunofluorescence
The fluorescence intensity and localization of the target protein were determined by immunofluorescence. Cells were fixed with 4% paraformaldehyde for 15 min. For 10 min, 0.1% Triton X-100 (BL934A, Biosharp, Hubei, Anhui, China) was infused into PBS. Afterward, the cells were sealed for 15 min with 2% FBS (BL2182A, Biosharp, Hubei, Anhui, China). The primary antibodies RCBTB1 (sc-1681, Santa Cruz Biotechnology, Santa Cruz, USA), NF1 (PA5-103218, Thermo Fisher Scientific, Waltham, MA, USA), and protein kinase Cε (PKCε) (ab63638, Abcam Cambridge, MA, USA) were incubated overnight at 4°C. On the next day, the secondary antibody (ab6728 or ab6721, Abcam Cambridge, MA, USA) was incubated for 2 h at room temperature after being washed 3 times with PBS. The cells were stained with 4',6-diamidino-2-phenylindole, C0065, Solarbio, Beijing, China, after being rinsed three times with PBS. Finally, fluorescence microscopy (CX41-32RFL, Olympus Corporation, Tokyo, Japan) was conducted, and ImageJ (version 1.8.0.345, National Institutes of Health, Bethesda, MD, USA) was used for analysis. Average optical density (AOD) = integral optical density (IOD)/Area
Quantitative real-time polymerase chain reaction
Total RNA was extracted by TRIzol reagent (19211ES, Yeasen, Shanghai, China) and quantified by the plate reader-based μDrop™ Plate (N12391, Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription was conducted using the ImProm-II™ Reverse Transcription System (A3800, Promega, Beijing, China). Primers [Table 1] were used to produce the quantitative polymerase chain reaction (qPCR) solution, which was then run through the reaction using a Bio-Rad qPCR apparatus (CFX96, Bio-RAD, Hercules, CA, USA). Gene expression was calculated using the 2−△△Ct method, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference.
| Primers | Primers sequences (5'-3') |
|---|---|
| RCBTB1-F | CACAGCGTGTGTGTGAACC |
| RCBTB1-R | GACAGGCTGCAATCTCTACCA |
| PKCε-F | ATGTGTGCAATGGGCGCAAG |
| PKCε-R | ATGTGTGCAATGGGCGCAAG |
| NF1-F | CGCAGCAGCACCCACATTTAC |
| NF1-R | ACTGTGGCGGGGACTCCTCA |
| ERK-F | GGGCAGGTGTTCGACGTGGGG |
| ERK-R | TAATCCTCTCAGGATCTGATA |
| IL-1β-F | CACCTCTCAAGCAGAGCACAG |
| IL-1β-R | GGGTTCCATGGTGAAGTCAAC |
| IL-6-F | CATTGGTAGTTGGGGTAGGA |
| IL-6-R | AGGCAGAGTCATTCAGAGC |
| IL-4-F | AGGAACACCACGGAGAACGA |
| IL-4-R | TTCAGACCGCTGACACCTCT |
| TNF-α-F | TTTGCTACGACGTGGGCTAC |
| TNF-α-R | ATCCGAGATGTGGAACTGGC |
| GAPDH-F | GCACCGTCAAGGCTGAGAAC |
| GAPDH-R | TGGTGAAGACGCCAGTGGA |
RCBTB1: RCC1 and BTB domain-containing protein 1, PKCε: RCBTB1 activates protein kinase C ε, NF1: Neurofibromin 1, IL: Interleukin, TNF-α: Tumor necrosis factor alpha, ERK: Extracellular regulated protein kinase, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
Western blot
The cells were lysed using a radioimmunoprecipitation assay (R0010, Solarbio, Beijing, China) solution after being cleaned with PBS. The protein concentration was measured using a bicinchoninic acid assay kit (BL521B, Biosharp, Hefei, Anhui, China). The proteins were separated using SDS-PAGE and subsequently transferred to polyvinylidene fluoride membranes (IPVH00010, Millipore Corporation, Billerica, MA, USA). The primary antibody (1:1000 dilution) was incubated overnight at 4°C. The second antibody (1:5000 dilution) was then incubated. The primary antibodies RCBTB1 (PA5-99183), extracellular regulated protein kinase (ERK) (13-8600), phosph-ERK (44-680G), phosph- mitogen-activated protein kinase kinase (MEK) (44-460G), MEK (PA5-88704), GAPDH (PA1-987), epidermal growth factor receptor (EGFR) (PA1-1110), NF1 (PA5-103218), and β-actin (PA1-183) and the goat anti-rabbit immunoglobulin G (H+L) secondary antibody (31460) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). The antibody PKCε (ab63638) was purchased from Abcam (Cambridge, MA, USA). They were rabbit polyclonal antibodies. Finally, the protein bands were observed using an enhanced chemiluminescence kit (BL520b, Biosharp, Hefei, Anhui, China). Image Quant LAS4000 (GE Healthcare, Chicago, IL, USA) was used to observe the protein bands, and ImageJ was used to analyze the gray values of the bands.
Bioinformatic analysis
Gene expression profiling interactive analysis (GEPIA, http://gepia.cancer-pku.cn/) is an online tool for analyzing gene expression and patient survival data. The procedure for analyzing RCBTB1 and its relationship to the prognosis of patients with ovarian cancer using the GEPIA website is as follows: The relationship between RCBTB1 expression and the overall survival or disease-free survival of patients with OC was analyzed through overall survival. . Sangerbox (version 3.0, http://sangerbox.com/) and data from the Cancer Genome Atlas (TCGA, https://www.cancer.gov/) were used to examine the association between RCBTB1 expression and prognosis in patients with OC. Then, the correlation between RCBTB1 expression and cytokines was analyzed. If the data conformed to a normal distribution, t-test was used to compare differences between the two groups. If the data fitted a non-normal distribution, the rank sum test was used to compare differences between the two groups. Bilateral P < 0.05 was considered statistically significant.
Statistical analysis
GraphPad Prism (version 9.0, GraphPad Software, Inc., San Diego, CA, USA) was used for statistical analysis. Student’s t-test was used for comparison between the two groups. One-way analysis of variance and Turkey’s multiple range tests were used to detect differences among groups. All data were shown as the mean ± standard deviation. P < 0.05 was considered significant.
RESULTS
Effect of silencing RCBTB1 on A2780 cells
Figure 1a shows that the expression of RCBTB1 in A2780 cells was significantly higher than that of IOSE-80 in normal ovarian cells (P < 0.001). RCBTB1 was significantly expressed in OC cells and subsequently silenced in A2780 cells. Figure 1b-d shows that RCBTB1 mRNA and protein expression were successfully silenced (P < 0.001). Figure 1e and f show that after RCBTB1 was silenced, the colony-formation ability of A2780 cells was significantly reduced (P < 0.001). Figure 1g demonstrates that the A2780 cell viability in the sh-RCBTB1 group was lower than that in the sh-NC group (P < 0.01). Transwell assay demonstrated that the migration and invasion abilities of A2780 cells were significantly reduced after silencing RCBTB1 (Figure 1h-j, P < 0.001). Finally, the wound-healing assay in Figure 1k and l demonstrated that the migration ability of A2780 was reduced after silencing RCBTB1 (P < 0.001).

Effect of silencing RCBTB1 on the NF1/Ras signal axis
Western blot was performed to investigate the potential mechanism of action of RCBTB1 in OC. Figure 2a-d shows that silencing RCBTB1 in A2780 cells resulted in significantly reduced phosphorylation levels of ERK and MEK. In the GST-RBD pull-down assay, the RCBTB1-silencing A2780 cells had significantly lower Ras-GTP levels than the sh-NC cells (P < 0.001). These results suggest that A2780 cells contain mutation-activated KRAS proteins. The expression levels of EGFR and NF1 were assessed to further explore the process by which RCBTB1 silencing affects the Ras signaling axis in KRAS mutant OC cells. Figure 2e-g shows that EGFR expression was not significantly changed in RCBTB1-silenced A2780 cells, whereas NF1 expression significantly increased (P < 0.001).

Tumorigenic effect of RCBTB1 in vivo
The role of RCBTB1 in OC was further verified in vivo. Figure 3a-c shows that after RCBTB1 was silenced, the tumor weight and volume decreased significantly (P < 0.001). IHC staining of Ki67 and cleaved caspased-3 showed that the expression of Ki67 decreased significantly, and whereas that of cleaved caspased-3 increased significantly in RCBTB1-silenced A2780 cells [Figure 3d-f] (P < 0.001). As shown in Figure 3g-j, the levels of interleukin (IL)-interleukin (soluble tumor necrosis factor receptors were significantly reduced after silencing RCBTB1 (P < 0.001). Meanwhile, the IL-4 levels increased significantly (P < 0.001). The expression levels of NF1 and Ras-GTP were verified in vivo. Figure 3k-n shows that silencing RCBTB1 increased the fluorescence intensity of NF1 (P < 0.01) and decreased the expression of Ras-GTP significantly (P < 0.001).

RCBTB1 activates PKCε and degrades NF1
Next, the biological interaction between RCBTB1 and NF1 was explored. As shown in Figures 4a and b, after RCBTB1 was silenced, the fluorescence intensity of RCBTB1 and PKCε in A2780 cells decreased significantly (P < 0.001).

The PKCε inhibitor EV1-2 was used to further demonstrate the link between PKCε and NF1. PKCε and RCBTB1 demonstrated a positive feedback relationship. As shown in Figures 4c and d, the positive signal of NF1 was strong (P < 0.001). However, the A2780 cell activity in the NC + EV1-2 group significantly decreased (P < 0.01, Figure 4e). The fluorescence signal of NF1 was significantly enhanced after EV1-2 treatment. Another inhibitor of PKCε, RO 31-8820, was used [Figure 4f and g]. The results demonstrated that NF1’s fluorescence intensity markedly increased following RO 31-8820 treatment (P < 0.001). Figure 4h shows that the activity of A2780 cells significantly decreased after treatment with RO 31-8220 (V 0.01). In Figures 4i and j, the mRNA levels of PKCε and RCBTB1 were significantly reduced after EV1-2 treatment in A2780 cells (P < 0.001). Subsequently, to further verify the relationship between RCBTB1, PKCε, and NF1, we overexpressed NF1 after silencing RCBTB1. As shown in Figure 4k-m, the number of migrating and invading cells decreased significantly after silencing RCBTB1 and overexpressing NF1 (P < 0.05). The mRNA level of NF1 increased significantly after overexpression of NF1 (Figure 4n, P < 0.01). Finally, the proliferation capacity and viability of A2780 cells after overexpression of NF1 were analyzed by cell clonogenesis and CCK-8 assay (Figure 4o-q). After NF1 was overexpressed, the proliferation (P < 0.05) and viability (P < 0.001) of A2780 cells decreased significantly.
Silencing RCBTB1 inhibits adaptive MEK inhibitor resistance
As shown in Figures 5a and b, the A2780 cells exhibited adaptive resistance to the MEK inhibitor AZD6244. Silencing RCBTB1 restored A2780 cells’ sensitivity to AZD6244 [Figure 5c]. The expression levels of PKCε, NF1, ERK, and Ras-GTP were not significantly different from that of shRCBTB1 after AZD6244 treatment [Figure 5d-h]. The colony-forming capacity and cell viability of sh-RCBTB1 + EV1-2 cells were not statistically different from those of shRCBTB1 cells [Figure 5i-k]. Combining all the results showed that by controlling the Ras axis, RCBTB1 has a significant influence on OC [Figure 6].


Analysis of RCBTB1 in OC
According to the correlation between RCBTB1 expression and prognosis, high expression of RCBTB1 may be associated with poor prognosis of OC patients [Figure 7a]. The expression characteristics and clinical significance of RCBTB1 in OC were analyzed using the TCGA database. Figure 7b illustrates the expression of RCBTB1 at different patient ages. The results found a significant difference between 61–80 years old and 41–60 and 21–40 years old (P < 0.001). Figure 7c shows that RCBTB1 was positively associated with OC (P < 0.05). In Figure 7d, RCBTB1 was positively correlated with CD4 cells, neutrophils, macrophages, and dendritic cells in OC (P < 0.01).

DISCUSSION
RCBTB1 is found on chromosome 13q14, which is frequently deleted in lymphocytic malignancies and B-cell chronic lymphocytic leukemia.[22] To date, studies have found that RCBTB1 plays a biological role in breast cancer,[23] sarcoma,[20] bladder cancer,[24] and rectal cancer.[25] In OC, RCBTB1 may act as a target gene for miR-21-3p.[21] However, the direct link and biological mechanism of action between RCBTB1 and OC are still unclear. The present study assessed the expression of RCBTB1 in OC tissues and cells. The results showed that these tissues and cells had high RCBTB1 expression. The expression of RCBTB1 was silenced to further explore the possible mechanism by which RCBTB1 affects OC.
OC is a chemotherapy-resistant disease with a low survival rate and a high recurrence rate.[26] Numerous investigations have demonstrated that the primary causes of OC, from early development to progression to invasion and metastasis, are several genes and their mutations.[27] In OC, Ras is a widely mutated gene, and the most prevalent Ras subtype is the KRAS mutation.[28] KRAS mutation status increased from normal ovarian to mucinous OC, indicating that KRAS mutation plays a key role in the succession of benign tumors to invasive OC.[29] Ras mutation leads to loss of GTPase activity and stabilization of GTP-binding conformation. Ras protein is negatively regulated by the tumor suppressor gene NF1. The neurofibromin of NF1 increases Ras’s GTPase activity, changing it through GRD from an active GTP-binding form to an inactive GDP-binding form.[30] The activation of intracellular Ras-GTP and the Ras/MAPK signaling pathways is sustained due to NF1 mutations that cause neurofibromin function to be lost, thereby increasing cell proliferation until tumor growth becomes uncontrollable. NF1 mutation further upregulates Ras signaling.[31] Ras proteins cycle between active GTP binding and GDP binding conformations to control the fate of cells.[32] The present study found that silencing RCBTB1 may inhibit KRAS-mutated OC tumor growth by inhibiting the NF1/Ras signaling axis. Therefore, RCBTB1 may play an important biological role in KRAS-driven OC progression. One study found that PKCε is the phosphorylation site for NF1 in glioblastoma cells.[33] However, the PKCα of the PKC family phosphorylates NF1 in cysteine-rich regions and promotes NF1 degradation.[34] Silencing RCBTB1 and blocking PKC activity promoted the expression of NF1 in OC cells.
Drug resistance is a challenging problem in OC treatment.[35] The results of a trial demonstrated that women with severe KRAS mutations and low-grade serous OC responded significantly to a combination of the aromatase inhibitor letrozole and the MEK inhibitor trametinib, but this effect was not seen with monotherapy.[36] Therefore, drug resistance caused by Ras mutations remains an urgent problem. In the present study, RCBTB1 was found to be a new driver of adaptive MEK inhibitor resistance in KRAS mutant OC. Silencing RCBTB1 restored the susceptibility of OC cells to MEK inhibitors and blocked the decline of NF1 and the activation of Ras and ERK. Studies have shown that RCBTB2 has adaptive MRK inhibitor resistance and may affect OC through the NF1/Ras/ERK signaling axis. Taken together, the present study found that RCBTB1 may regulate the RAS signaling axis to play a carcinogenic role in OC and MEK inhibitors.
In addition, this study found that a high expression of RCBTB1 is associated with poor prognosis in patients with OC and that RCBTB1 is highly expressed in patients aged 61– 80 years. Dendritic cells develop from bone marrow-derived hematopoietic stem cells and are dispersed throughout lymphoid and non-lymphoid tissues and organs.[37] For many years, CD4+ T cells were primarily considered helper cells that support and enhance antitumor immunity. Numerous data suggest that a subset of CD4+ T cells can directly kill cancer cells (and infected cells) in an antigen-specific manner.[38-40] Neutrophils are thought to consist of homogeneous cell populations that exhibit powerful antimicrobial functions, including phagocytosis, degranulation, and neutrophil extracellular traps.[41] Macrophages are highly plastic cells with multiple functions, including tissue development and homeostasis, removal of cell debris, elimination of pathogens, and regulation of inflammatory responses.[42] The present study showed that these inflammation-related cells were positively correlated with RCBTB1 in OC.
This study has some limitations. This study discussed OC only, but OC has many subtypes. Hence, in the follow-up study, multiple subtypes of OC tissues and cells will be used to further prove the role of RCBTB1. Other possible mechanisms by which RCBTB1 affects OC must be explored to provide a more comprehensive theoretical basis for the treatment of OC.
SUMMARY
Silencing RCBTB1 may inhibit adaptive MEK inhibitor resistance in KRAS mutant OC by modulating the NF1/Ras signaling axis. This study revealed the biological interaction between RCBTB1 and NF1/Ras signaling axes and provides a new perspective for OC therapy with KRAS mutations.
AVAILABILITY OF DATA AND MATERIALS
The datasets used and/or analyzed during the current study were available from the corresponding author on reasonable request.
ABBREVIATIONS
OC: Ovarian cancer
RCC1: Regulator of chromosome condensation
RCBTB1: RCC1 and BTB domain-containing protein 1
qRT-PCR: Quantitative real-time polymerase chain reaction
IHC: Immunohistochemistry
NF1: Neurofibromin 1
Ras: Rat sarcoma
KRAS: Kirsten rat sarcoma viral oncogene
ERK: Extracellular regulated protein kinase
MEK: Mitogen-activated protein kinase kinase
HRAS: Harvey rat sarcoma viral oncogene homolog
NRAS: Neuraminidase
GTP: Guanosine triphosphate
EV1-2: Epsilon-V1-2
PBS: Phosphate buffer saline
MTT: Methylthiazolyldiphenyl-tetrazolium bromide
SDS-PAGE: Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
PKCε: Protein kinase Cε
AOD: Average optical density
IOD: Integral optical density
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
IL: Interleukin
TNF-α: Tumor necrosis factor alpha
EGFR: Epidermal growth factor receptor
AUTHOR CONTRIBUTIONS
GWZ and LMS: Designed the study; all authors conducted the study; XCX and BRQ: Collected and analyzed the data; XCX and GWZ: Participated in drafting the manuscript; and all authors contributed to critical revision of the manuscript for important intellectual content. All authors gave final approval of the version to be published. All authors participated fully in the work, took public responsibility for appropriate portions of the content, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or completeness of any part of the work were appropriately investigated and resolved. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Harbin Zhongke Saiens Biotechnology Co., Ltd . The study was approved by the Institutional Animal Care and Use Committee of Harbin Zhongke Saiens Biotechnology Co., Ltd. (HRBSCIEC20230301). Informed consent to participate is not required as this study does not involve human experiments.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Fund projects: Study on the Induction of Elevated Th2 Cell Rate and Treatment Tolerance and Early Recurrence in Cervical Cancer Patients by Radiotherapy and Chemotherapy (22A200152).
References
- Ovarian cancer In: StatPearls. Treasure Island, FL: StatPearls Publishing; 2024. Available from: https://www.ncbi.nlm.nih.gov/books/NBK567760/?report=reader
- [Google Scholar]
- Epithelial ovarian cancer: Evolution of management in the era of precision medicine. CA Cancer J Clin. 2019;69:280-304.
- [CrossRef] [PubMed] [Google Scholar]
- Recent progress in the diagnosis and treatment of ovarian cancer. CA Cancer J Clin. 2011;61:183-203.
- [CrossRef] [PubMed] [Google Scholar]
- Epithelial ovarian cancer: Review article. Cancer Treat Res Commun. 2022;33:100629.
- [CrossRef] [PubMed] [Google Scholar]
- Epithelial ovarian cancer risk: A review of the current genetic landscape. Clin Genet. 2020;97:54-63.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular subclasses of clear cell ovarian carcinoma and their impact on disease behavior and outcomes. Clin Cancer Res. 2022;28:4947-56.
- [CrossRef] [PubMed] [Google Scholar]
- Targeting DNA repair pathway in cancer: Mechanisms and clinical application. MedComm. 2021;2:654-91.
- [CrossRef] [PubMed] [Google Scholar]
- KRAS or BRAF mutation status is a useful predictor of sensitivity to MEK inhibition in ovarian cancer. Br J Cancer. 2008;99:2020-8.
- [CrossRef] [PubMed] [Google Scholar]
- RAS-mediated oncogenic signaling pathways in human malignancies. Semin Cancer Biol. 2019;54:1-13.
- [CrossRef] [PubMed] [Google Scholar]
- Understanding Ras: “It ain't over 'til it's over”. Trends Cell Biol. 2000;10:147-54.
- [CrossRef] [PubMed] [Google Scholar]
- The Frequency of RAS mutations in cancer. Cancer Res. 2020;80:2969-74.
- [CrossRef] [PubMed] [Google Scholar]
- Significance of Ras signaling in cancer and strategies for its control. Oral History Review. 2015;11:147.
- [CrossRef] [Google Scholar]
- KRAS mutation: From undruggable to druggable in cancer. Sig Transduct Target Ther. 2021;6:386.
- [CrossRef] [PubMed] [Google Scholar]
- The current understanding on the impact of KRAS on colorectal cancer. Biomed Pharmacother. 2021;140:111717.
- [CrossRef] [PubMed] [Google Scholar]
- KRAS and BRAF mutations in ovarian tumors: A comprehensive study of invasive carcinomas, borderline tumors and extraovarian implants. Gynecol Oncol. 2006;103:883-7.
- [CrossRef] [PubMed] [Google Scholar]
- Downregulation of Rab23 inhibits proliferation, invasion, and metastasis of human ovarian cancer. Int J Biochem Cell Biol. 2019;116:105617.
- [CrossRef] [PubMed] [Google Scholar]
- Genome-wide interaction study identifies RCBTB1 as a modifier for smoking effect on carotid intima-media thickness. Arterioscler Thromb Vasc Biol. 2014;34:219-25.
- [CrossRef] [PubMed] [Google Scholar]
- Clld7, a candidate tumor suppressor on chromosome 13q14, regulates pathways of DNA damage/ repair and apoptosis. Cancer Res. 2010;70:9434-43.
- [CrossRef] [PubMed] [Google Scholar]
- Deep clinical phenotyping and gene expression analysis in a patient with RCBTB1-associated retinopathy. Ophthalmic Genet. 2021;42:266-75.
- [CrossRef] [PubMed] [Google Scholar]
- RCBTB1 Deletion is associated with metastatic outcome and contributes to docetaxel resistance in nontranslocation-related pleomorphic sarcomas. Cancers (Basel). 2019;11:81.
- [CrossRef] [PubMed] [Google Scholar]
- Targeting miR-21-3p inhibits proliferation and invasion of ovarian cancer cells. Oncotarget. 2016;7:36321-37.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular pathogenesis of endometriosis-associated clear cell carcinoma of the ovary (Review) Oncol Rep. 2009;22:233-40.
- [CrossRef] [Google Scholar]
- Microarray meta analysis of BRCA1 mutated genes involved in breast cancer. Open Access Libr J. 2018;5:1-14.
- [CrossRef] [Google Scholar]
- Understanding the development of human bladder cancer by using a whole-organ genomic mapping strategy. Lab Investig. 2008;88:694-721.
- [CrossRef] [PubMed] [Google Scholar]
- A Preliminary study on the pathogenesis of colorectal cancer by constructing a Hsa-circRNA-0067835-miRNA-mRNA regulatory network. Onco Targets Ther. 2021;14:4645-58.
- [CrossRef] [PubMed] [Google Scholar]
- Cellular mechanism of gene mutations and potential therapeutic targets in ovarian cancer. Cancer Manag Res. 2021;13:3081-100.
- [CrossRef] [PubMed] [Google Scholar]
- Ovarian cancers: Genetic abnormalities, tumor heterogeneity and progression, clonal evolution and cancer stem cells. Medicines (Basel). 2018;5:16.
- [CrossRef] [PubMed] [Google Scholar]
- K-Ras4A splice variant is widely expressed in cancer and uses a hybrid membrane-targeting motif. Proc Natl Acad Sci U S A. 2015;112:779-84.
- [CrossRef] [PubMed] [Google Scholar]
- Role of RAS signaling in ovarian cancer. F1000Res. 2022;11:1253.
- [CrossRef] [PubMed] [Google Scholar]
- A genome-scale RNA interference screen implicates NF1 loss in resistance to RAF inhibition. Cancer Discov. 2013;3:350-62.
- [CrossRef] [PubMed] [Google Scholar]
- Cooperation between noncanonical ras network mutations. Cell Rep. 2015;10:307-16.
- [CrossRef] [Google Scholar]
- The guanine nucleotide-binding switch in three dimensions. Science. 2001;294:1299-304.
- [CrossRef] [PubMed] [Google Scholar]
- Nuclear import mechanism of neurofibromin for localization on the spindle and function in chromosome congression. J Neurochem. 2016;136:78-91.
- [CrossRef] [PubMed] [Google Scholar]
- Proteasomal and genetic inactivation of the NF1 tumor suppressor in gliomagenesis. Cancer Cell. 2009;16:44-54.
- [CrossRef] [PubMed] [Google Scholar]
- The crosstalk between STAT3 and p53/RAS signaling controls cancer cell metastasis and cisplatin resistance via the Slug/ MAPK/PI3K/AKT-mediated regulation of EMT and autophagy. Oncogenesis. 2019;8:59.
- [CrossRef] [PubMed] [Google Scholar]
- KRAS-Mutated, estrogen receptor-positive low-grade serous ovarian cancer: Unraveling an exceptional response mystery. Oncologist. 2021;26:e530-6.
- [CrossRef] [PubMed] [Google Scholar]
- Review of dendritic cells, their role in clinical immunology, and distribution in various animal species. Int J Mol Sci. 2021;22:8044.
- [CrossRef] [PubMed] [Google Scholar]
- Tumor-reactive CD4(+) T cells develop cytotoxic activity and eradicate large established melanoma after transfer into lymphopenic hosts. J Exp Med. 2010;207:637-50.
- [CrossRef] [PubMed] [Google Scholar]
- Naive tumor-specific CD4(+) T cells differentiated in vivo eradicate established melanoma. J Exp Med. 2010;207:651-67.
- [CrossRef] [PubMed] [Google Scholar]
- Tumor-specific cytolytic CD4 T cells mediate immunity against human cancer. Sci Adv. 2021;7:eabe3348.
- [CrossRef] [PubMed] [Google Scholar]
- Granulocytes and mast cells. Wolters Kluwer Health/Lippincott Williams and Wilkins 2012:468-86.
- [Google Scholar]
- Macrophages: Development and tissue specialization. Annu Rev Immunol. 2015;33:643-75.
- [CrossRef] [PubMed] [Google Scholar]


