Translate this page into:
Silencing C-X-C motif chemokine receptor inhibited autophagy of hippocampal neurons in epileptic mice by upregulating TWIK-related K+ Channel 1

*Corresponding author: Qiannan Song, Graduate School of Heilongjiang University of Chinese Medicine, Harbin, China. m16643000808@163.com
-
Received: ,
Accepted: ,
How to cite this article: Chen H, Wang W, Feng D, Chen Q, Guo T, Song Q. Silencing C-X-C motif chemokine receptor inhibited autophagy of hippocampal neurons in epileptic mice by upregulating TWIK-related K+ Channel 1. CytoJournal. 2026;23:13. doi: 10.25259/Cytojournal_252_2024
Abstract
Objective:
Epilepsy is a neurological disease whose onset causes a variety of sequelae, reducing the standard of living. TWIK-related K+ channel 1 (TREK-1) has been linked to epilepsy. C-X-C motif chemokine receptor (CXCR2) is a potential target for the treatment of epilepsy inflammation. This work aims to observe the effect of CXCR2 expression on neuron autophagy and TREK-1 expression in the hippocampus of epileptic mice.
Material and Methods:
An animal model of epilepsy was established, and the CXCR2 gene was silenced. The expression of TREK-1, interleukin (IL)-1b, tumor necrosis factor-a, and IL-6 in the hippocampus of mice was detected by quantitative real-time polymerase chain reaction. Autophagy-related proteins beclin-1 and microtubule-associated protein light chain 3 (LC3) were examined by Western blot. Cell proliferation and activity were analyzed using cell counting kit-8 and 5-Bromodeoxyuridine assays.
Results:
Compared with that in the normal group, TREK-1 expression decreased and CXCR2 expression increased significantly in the hippocampus of epileptic model mice (P < 0.01). Two autophagy markers, beclin-1 and LC3 II/LC3 I, showed an increased expression in the hippocampal regions of the epileptic model group (P < 0.01). In addition, B-cell lymphoma 2 (Bcl-2)-associated X protein levels increased and Bcl-2 levels decreased in the epileptic mice (P < 0.01). After CXCR2 silencing, the expression of proinflammatory factor in the hippocampus of epileptic mice significantly decreased (P < 0.01). In vitro, cell viability and proliferation increased significantly after silencing CXCR2 (P < 0.05). Meanwhile, the expression levels of TREK-1 and Bcl-2 significantly increased (P < 0.001) and the levels of autophagy markers decreased in vivo and in vitro (P < 0.01). In vivo, CXCR2 expression did not change significantly after silencing TREK-1. After silencing TREK-1 and overexpressing CXCR2, the proliferation ability of HT22 cells decreased significantly (P < 0.001).
Conclusion:
Epileptic mice’s hippocampal neuronal damage can be ameliorated by CXCR2 suppression. One possible explanation is that epileptic mice’s hippocampus tissues express more TREK-1, which prevents excessive neuronal autophagy and lowers apoptosis.
Keywords
Autophagy
C-X-C motif chemokine receptor
Epilepsy
TWIK-related K+ channel 1
INTRODUCTION
A frequent disorder of the neurological system, epilepsy has a complicated etiology.[1] Autophagy is the process of a cell swallowing its own cytoplasmic proteins or organelles, encapsulating them into vesicles, merging with lysosomes to produce autophagolysosomes, and breaking down the contents enclosed in them.[2] In a physiological state, autophagy is a process in which cells remove their damaged or senescent organelles, which has positive effects.[3] However, under pathological conditions such as ischemia and hypoxia, excessive or insufficient autophagy can lead to diseases.[4] When epilepsy continues, the brain neuron cells continue to abnormal discharge, the accumulation of metabolic waste, more than physiological autophagy, resulting in cell death.[5]
The nervous system contains a large distribution of the two-pore potassium channel TWIK-related K+ channel 1 (TREK-1), which is controlled by a number of regulatory variables, including several neuroprotective drugs.[6,7] TREK-1 is closely associated with neurological disorders such as epilepsy.[8] Research has demonstrated that TREK-1 provides protection against brain ischemia and epilepsy.[9] However, there are no agonists and antagonists specific to TREK-1. In addition, its role in maintaining normal neural activity and its involvement in nerve injury and repair remain to be further elucidated.
Among the several chemokine receptors found in the cytoplasm and on the cell surface, is C-X-C motif chemokine receptor 2 (CXCR2).[10] CXCR2 has played an important role in many aspects, including cancer, viruses (COVID-19), and physiology.[11,12] It is closely associated with the central nervous system (CNS) and is expressed in oligodendrocytes and neutrophils.[13] CXCR2 KO mice recovered well from experimental autoimmune encephalomyelitis.[14] However, the specific pathway of CXCR2 in epilepsy is unclear. This experiment investigates the changes of autophagy-related factors and TREK-1 and its pathological changes after CXCR2 silencing intervention in epileptic animals to determine how autophagy is regulated and how it protects hippocampus neurons in epileptic mice by silencing CXCR2. The findings will enhance our understanding of the key regulatory mechanisms that alleviate inflammation in mice with epilepsy. This effort contributes to the molecular basis of epilepsy inflammation and provides valuable insights for identifying new therapeutic targets to combat epilepsy.
MATERIAL AND METHODS
Cell culture
HT22 cells (BFN60808571) were provided by American Type Culture Collection (Manassas, VA, USA). Short tandem repeat (STR) research showed that the cells were descended from their parental cells and were clear of mycoplasma. The cells were mainly inoculated in culture bottles (4 mL/bottle) at a density of 1 × 105 cells/mL in a 5% carbon dioxide and 37°C incubator. Cell passage was carried out after cell fusion reached 80%. Dulbecco’s modified eagle medium (12491015, Gibco, Life Technologies, Rockville, MD, USA) containing 10% fetal bovine serum (A5256701, Invitrogen, Grand Island, NY, USA) was added after digestion at 37°C for 5 min with 0.5% trypsin (including ethylenediaminetetraacetic acid, 15400054, Gibco, Life Technologies, Rockville, MD, USA).
Cell transfection
HT22 cells were inoculated in a six-well plate at a density of 1 × 105. When the cell density reached 50-60%, the cells were transfected with CXCR2 overexpression plasmid (30 nM, forward, 5'-GTCGACAGATCTATGGAAGAT TTTAACATGGAG-3' and reverse, 5'-GACATCAGATC TGTAATTATGGCAAGGGGTGAG-3'), TREK-1 small interfering RNA (siRNA) (30 nM, 5'-CACGACCATTAATGTTATGAA-3'), and CXCR2 siRNA (30 nM, forward, 5'-TGCATCAGTGTGGACCGTTA-3', reverse, 5'-CCGCC AGTTTGCTGTATTG-3') using Lipofectamine 2000 reagent (11668500, Invitrogen, Carlsbad, CA, USA). All plasmids were supplied by Thermo Fisher Scientific (Waltham, MA, USA). After 24 h, the gene interference efficiency was verified by quantitative real-time polymerase chain reaction (qRTPCR). All plasmids were designed and purchased from Qiagen (Hilden, German). Interleukin (IL)-1b (10 ng/mL, ILB-M51H3, ACROBiosystems, Beijing, China) was used to treat HT22 cells and construct an epilepsy cell model. The cells were grouped as follows: Control, IL-1b, IL-1b+siCtrl (IL-1b + negative control to CXCR2 siRNA), IL-1b+siCXCR2 (IL-1b + CXCR2 siRNA), IL-1b+OV-NC+siCtrl (IL-1b + negative control to overexpress CXCR2 + negative control to TREK-1 siRNA), IL-1b+OV-CXCR2 (IL-1b + CXCR2 overexpression), and IL-1b+OV-CXCR2+si-TREK-1 (IL-1b + CXCR2 overexpression + TREK-1 siRNA).
Animal model of epilepsy
Forty male C57BL/6 specific pathogen free mice (6 weeks, 20-25 g) were bought from Beijing Vital River Laboratory Animal Technology Co., Ltd. (SCXK [Jing] 2016-0006). All animal procedures were performed in accordance with the Guidelines for the Care and Use of Heilongjiang University of Chinese Medicine. This study was approved by the Institutional Animal Care and Use Committee of Heilongjiang University of Chinese Medicine (HLJU-20220934). The animals were randomly assigned to four groups after a week of adaptive feeding: Control, epilepsy, siCtrl (negative control HT22 cells), and siCXCR2 (CXCR2 knockdown HT22 cells were injected into the brain). Each group consisted of ten mice. The steps for inducing epilepsy were as follows: Atropine sulfate (17 mg/kg, HY-B1205A, MedChemExpress, Monmouth Country, NJ, USA) was first intraperitoneally injected, followed by pilocarpine hydrochloride (180 mg/kg,[15] HY-B0726, MedChemExpress, Monmouth Country, NJ, USA) 30 min later. After administration, animal behavior was observed according to the classic Racine (1972) epileptic seizure criteria in experimental animals.[8] After 30 min of injection, animals without grade 4 or more attacks were additionally injected with 1/3 of the first dose of pilocarpine every 15 min. Mice without grade 4 or above attack after additional injection for 2 times. According to Racine standard, this phenomenon is regarded as modeling failure and will not be included in the next behavioral observation. The molding success rate was 83%. Diazepam (10 mg/kg; 1185020, Sigma, St. Louis, MO, USA) was intraperitoneally injected after 1 h of epileptic seizure for termination. All the mice were sacrificed by cervical dislocation and then dissected. Their hippocampi were collected and frozen at −80°C.
Modified neurological severity score (mNSS)
mNSS is widely used to assess neurological deficits and ranges from 1 to 18.[16] It includes five categories: Tail bending (3 points), floor walking (3 points), response to visual and tactile stimuli and limb muscle conditions (2 points), balance on the beam (6 points), and lack of reflexes and epileptic activity (4 points).[17] The score can reflect the muscle status and balance of mice: 1 = Normal function, 18 = Maximum deficit. The higher the score, the more serious the neurological function injury. All mice were tested blind.
Cell counting kit-8 (CCK-8)
Cell viability was detected by CCK-8 (CK04, Dojindo Laboratories, Kumamoto, Japan). In brief, 10% CCK-8 solution was added to a 96-well cell plate at 100 μL/well. The cells were continued to be incubated in the cell culture box for 4 h. The 96-well cell plate was placed in a microplate reader (iD5, Molecular Devices, Sunnyvale, Silicon Valley, USA), and the absorbance value of each well was detected at 450 nm.
5-Bromodeoxyuridine (BrdU) assay
The cells were labeled with 10 μM BrdU (ST1056, Beyotime Biotechnology, Shanghai, China) for 30 min. Inoculation was carried out on a cover glass coated with poly-L-lysine at a concentration of 3 × 104 per well in a 24-well plate. After 6 h of culture, the cells were fixed in 4% paraformaldehyde (P0099, Beyotime Biotechnology, Shanghai, China) at 4°C for 2 h. Proliferating cells was detected with the anti-BrdU antibody (1:1000: PA5-32256, Thermo Fisher Scientific, Waltham, MA, USA) prelabeled with Zenon Alexa Fluor 488 rabbit immunoglobulin G labeling kit (Z25302, Thermo Fisher Scientific, Waltham, MA, USA). Nuclei were stained with 4',6-diamidino-2'-phenylindole (DAPI, C1005, Thermo Fisher Scientific, Waltham, MA, USA) at room temperature for 10 min. BrdU-labeled cells were counted by fluorescence microscopy (BX51FL, Olympus Corporation, Tokyo, Japan), and their ratio to the total number of cells was calculated.
Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) staining assay
The cells were fixed with 4% paraformaldehyde at room temperature for 20 min and then incubated with Triton X-100 (T8200, Solarbio, Beijing, China) at room temperature for 5 min to increase permeability. After washing with phosphate-buffered saline (PBS), 50 μL of TUNEL (T2191, Solarbio, Beijing, China) reaction liquid was added and the mixture was reacted at 37°C for 1 h without light. The images were observed under a microscope.
5-Ethynyl-2'-deoxyuridine (EdU) staining assay
The cells were inoculated in 96-well plates at 10 μL cell suspension (1 × 104 cells) per well. Each well was added with 100 μL of EdU (CA1173, Solarbio, Beijing, China) working solution, incubated at 37°C for 2 h, and washed with PBS twice for 3 min each. The cells were fixed at room temperature by adding 50 μL of 4% paraformaldehyde and then incubated with 0.5% Triton-X (IT9100, Solarbio, Beijing, China) at room temperature for 10 min. DAPI was used to stain the nuclei for 10 min at room temperature. Finally, PBS was used for washing, and fluorescence microscopy was used to photograph and count the cells.
Reactive oxygen species (ROS) staining
Intracellular ROS levels were analyzed with ROS assay kit (S0033S, Beyotime Biotechnology, Beijing, China). The cells were inoculated in 96-well plates and incubated with 10 μM 2', 7'-dichlorofluorescein-diacetate at 37°C for 20 min. Observation was performed by fluorescence microscopy, and excitation at 488 nm and emission at 525 nm were measured using a fluorescence spectrophotometer (Cary Eclipse, Agilent, Santa Clara, California, USA).
qRT-PCR
RNA concentration and purity were checked after TRIzol extraction (DP451, Tiangen Biotechnology Co., Ltd., Beijing, China). Reverse transcriptase and random primers were used to reverse transcribe RNA into complementary DNA (cDNA) (KR123, Tiangen Biotechnology Co., Ltd, Beijing, China). The PCR reaction conditions were 37°C for 60 min. The produced cDNA reaction solution was kept cold at −20°C. The PCR amplification reaction system consisted of the following: Forward primer 2 μL, reverse primer 2 μL, 2× synergetic binding reagent green mix 9 μL, cDNA 2 μL, and RNase-Free ddH2O 5μL. The PCR reaction program was as follows: 40 cycles of 94°C for 2 min, 94°C for 20 s, and 60°C for 34 s. The 2−ΔΔCt method was used to quantitatively analyze the data. Total glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was used as the internal messenger RNA (mRNA) control. All primer sequences are listed in Table 1.
| Forward (5'-3') | Reverse (5'-3') | |
|---|---|---|
| IL-1β | TTGACGGACCCCAAAAGATG | AGAAGGTGCTCATGTCCTCA |
| IL-6 | GTTCTCTGGGAAATCGTGGA | TGTACTCCAGGTAGCTATGG |
| TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
| CXCR2 | ATGCCCTCTATTCTGCCAGAT | GTGCTCCGGTTGTATAAGATGAC |
| TREK-1 | GTCCTCTACCTGATCATCGGAGC | CCTAGCTGATCACCAACCCC |
| Bax | AGACAGGGGCCTTTTTGCTAC | AATTCGCCGGAGACACTCG |
| Bcl-2 | GCTACCGTCGTGACTTCGC | CCCCACCGAACTCAAAGAAGG |
| Beclin-1 | AGGTTGAGAAAGGCGAGACA | TTTTGATGGAATAGGAGCCG |
| LC3 | GACGGCTTCCTGTACATGGTTT | TGGAGTCTTACACAGCCATTGC |
| p53 | GGAAATTTGTATCCCGAGTATCTG | GTCTTCCAGTGTGATGATGGTAA |
| GAPDH | CACTGCCACCCAGAAGACTG | CCAGTGAGCTTCCCGTTCAG |
IL: Interleukin, , CXCR2: C-X-C motif chemokine receptor, TREK-1: TWIK-related K+Channel 1, LC3: Light chain 3, Bcl-2: B-cell lymphoma-2, BAX: Bcl-2-associated X protein, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine.
Western blot
For liquid nitrogen grinding, 100 mg of tissue was added with 1000 μL of radioimmunoprecipitation assay (R0010, Solarbio, Beijing, China) protein lysis solution. After thoroughly mixing the mixture, it was divided for 30 min and centrifuged for 20 min at 12,000 rpm. For future usage, the supernatant was transferred to a fresh centrifuge tube. The protein concentration of samples was determined using a bicinchoninic acid assay kit (P0010, Beyotime Biotechnology, Shanghai, China). The primary antibodies CXCR2 (1:1000, ab 89254), TREK-1 (1:1000, ab90855), B-cell lymphoma 2 (Bcl-2, 1:1000, ab182858), Bcl-2-associated X protein (BAX, 1:1000, ab32503), beclin-1 (1:1000, ab207612), light chain 3 (LC3, 1: 1000, ab192890), and GAPDH (1: 1000, ab9485) were incubated overnight at 4 °C. The second antibody (1:5000, ab6721 or ab205719) was incubated for 1 h, and enhanced chemiluminescence luminescent solution (BL520b, Biosharp Life Scinece, Hefei, Anhui, China) was used for exposure. GAPDH was employed as the internal reference. Protein bands were analyzed by Amersham ImageQuant 800 (Cytiva, Uppsala, Sweden) and Image J (v1.8.0.345, National Institutes of Health, Bethesda, MD, USA). All antibodies were obtained from Abcam (Cambridge, MA, USA).
Statistical analysis
Statistical analysis was conducted with Statistical Package for the Social Sciences 17.0 software (IBM Corp., Armonk, NY, USA). All data were expressed as mean ± standard deviation. When the distribution was normal, one-way analysis of variance was used for between-group comparison and least significant difference test for pairwise comparison. Unpaired t-test was used for comparison between two groups. P < 0.05 was considered statistically significant.
RESULTS
Expression level of TREK-1, CXCR2, and cytokines in the hippocampus of the epilepsy model
The epilepsy model group exhibited statistically significant increases in the expression levels of IL-1b, tumor necrosis factor-alpha (TNF-a), and IL-6 [Figure 1a-c], (P < 0.01). TREK-1 mRNA expression in the hippocampus tissues of the epilepsy model group was lower [Figure 1d], (P < 0.01). As shown in Figures 1e and f, the protein expression level of CXCR2 in epileptic mice was significantly increased (P < 0.001). These results suggest that CXCR2 expression is increased and TREK-1 expression is decreased in epileptic mice. In addition, epilepsy promotes the secretion of pro-inflammatory factors.

- Decreased TREK-1 expression in the hippocampus. (a) was collected, and the expression of IL-1b mRNA level in hippocampal tissue. (b) TNF-a mRNA level in hippocampal tissue. (c) IL-6 mRNA level in hippocampal tissue. (d) TREK-1 mRNA level in hippocampal tissue. (e and f) Detection of CXCR2 expression in hippocampus. n = 3. ✶✶P < 0.01, ✶✶✶P < 0.001. IL: Interleukin, TNF-alpha: Tumor necrosis factor-a, TREK1: TWIK-Related K+ channel 1, CXCR2: C-X-C motif chemokine receptor, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, mRNA: Messenger RNA.
Increased autophagy in the hippocampal tissue of epilepsy model group
Figure 2a shows that the mRNA level of anti-apoptosis-related protein Bcl-2 was downregulated in the epilepsy model group. Meanwhile, the apoptosis-related proteins BAX and p53 mRNA levels were upregulated [Figure 2b and c]. In the hippocampal tissues of the model group, the expression levels of hallmark proteins linked to autophagy, LC3 II/LC3 I and beclin-1, were elevated [Figure 2d and e], (P < 0.01). Figure 2f and g show that the epilepsy model group had a significantly decreased expression level of Bcl-2 and significantly increased levels of BAX and p53 (P < 0.05). Beclin-1 and LC3 II/LC3 I, two autophagy-related marker proteins, had high expression levels in the model group (P < 0.01). These results suggest that epilepsy promotes autophagy and apoptosis.

- Increased autophagy in the hippocampus of epilepsy model group. (a) Relative mRNA expression of Bcl-2. (b) Relative expression of BAX mRNA. (c) Relative expression of p53 mRNA. (d) Relative mRNA expression of LC3 II/LC3 I after different treatments. (e) Relative mRNA expression of beclin-1. (f and g) Western blot detection of the expression changes of apoptosis and autophagy-related indexes. n = 3. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. Bcl-2: B-cell lymphoma-2, BAX: Bcl-2-associated X protein, LC3: Microtubule-associated protein 1A/1B-light chain 3, mRNA: Messenger RNA.
Silencing CXCR2 inhibits the expression of proinflammatory cytokines in epilepsy
First, the silencing efficiency of CXCR2 was verified by PCR and western blot. As shown in Figure 3a-c, CXCR2 expression decreased significantly at molecular and RNA levels after silencing. We then evaluated the effect of CXCR2 on epileptic mice using mNSS assay. Figure 3d shows that the mNSS of the model group was significantly higher and that of the siCXCR2 group was significantly reduced compared with the score of the model group (P < 0.001). IL-1b, TNF-a, and IL-6 were downregulated in the siCXCR2 group [Figure 3e-g], (P < 0.01). Western blot detected an elevated TREK-1 expression in the hippocampus of the siCXCR2 group (P < 0.001) [Figure 3h and i]. In summary, after CXCR2 silencing, the expression of proinflammatory factor was inhibited and TREK-1 expression was increased in the epileptic model.

- CXCR2 silencing has an anti-epileptic effect. (a) Validation of CXCR2 silencing efficiency at the RNA level. (b and c) Validation of CXCR2 silencing efficiency at the protein level. (d) mNSS score. (n = 10) (e) IL-1b mRNA level in hippocampal tissue. (f) Hippocampal tissue was collected, and TNF-a expression was detected by qRT-PCR. (g) IL-6 mRNA level in hippocampal tissue. (h and i) TREK-1 level in hippocampal tissue. n = 3. ns: No significant difference, ✶✶P < 0.01, ✶✶✶P < 0.001. CXCR2: C-X-C motif chemokine receptor, TREK-1: TWIK-Related K+ channel 1, IL: Interleukin, TNF-a: Tumor necrosis factor-a, mRNA: Messenger RNA, qRT-PCR: quantitative real-time polymerase chain reaction, mNSS: Modified neurological severity score.
Silencing CXCR2 inhibits the autophagy of hippocampal neurons
The expression levels of hippocampal autophagy-related hallmark genes were higher in the model group. In Figure 4a, Bcl-2 mRNA expression was upregulated after siCXCR2 treatment (P < 0.01). Meanwhile, the mRNA expression levels of Bax and p53 were downregulated (Figure 4b and c], (P < 0.01), indicating that siCXCR2 reduces apoptosis. In the hippocampal regions of the siCXCR2 group, the mRNA expression levels of autophagy-related proteins LC3 and beclin-1 were downregulated [Figure 4d and e], (P < 0.05). Western blot results showed that the expression levels of autophagy-related markers LC3 II/LC3 I and beclin-1 were downregulated in the siCXCR2 group [Figure 4f and g], (P < 0.01). After CXCR2 was silenced, the expression levels of Bcl-2 significantly increased (P < 0.01) and those of BAX and p53 significantly decreased (P < 0.001). In summary, CXCR2 silencing inhibited apoptosis and autophagy in the epileptic models.

- CXCR2 silencing inhibits autophagy in hippocampal neurons. (a) Bcl-2 mRNA level. (b) BAX mRNA level. (c) p53 mRNA level. (d) LC3 II/LC3 I mRNA level. (e) Beclin-1 mRNA level. (f and g) Western blot detection of the expression changes of apoptosis and autophagy-related indexes. n = 3. ✶✶ P < 0.01, ✶✶✶ P < 0.001. CXCR2: C-X-C motif chemokine receptor, mRNA: Messenger RNA, Bcl-2: B-cell lymphoma-2, BAX: Bcl-2 associated X protein, LC3: Light chain 3.
Silencing CXCR2 promotes neuronal cell proliferation
The effect of siCXCR2 on neuron activity was analyzed by CCK-8 experiment. In Figure 5a, cell activity decreased after IL-1b treatment (P < 0.01) and was enhanced after siCXCR2 treatment (P < 0.05). As shown in Figure 5b and c, the ROS levels significantly increased after IL-1b treatment and significantly decreased after CXCR2 silencing (P < 0.01). BrdU staining results further showed that the number of BrdU-positive cells in the IL-1b group decreased (P < 0.001). Meanwhile, the proportion of BrdU-positive cells increased in the IL-1b+siCXCR2 group [Figure 5d and e], (P < 0.001). In summary, CXCR2 silencing inhibited IL-1b-induced apoptosis and increased cell viability in the HT22 cell model of epilepsy.

- Silencing CXCR2 promotes neuronal cell proliferation. (a) Cell proliferation rate was detected by CCK-8. (b and c) Intracellular ROS levels were evaluated by DCFH-DA fluorescence staining. Scale bar=50 μm. Objective: 400×. (d and e) BrdU detection of cell proliferation rate. Scale bar=100 μm. Objective: 200×. n = 3. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. CXCR2: C-X-C motif chemokine receptor, CCK-8: Cell counting kit-8, ROS: Reactive oxygen species, BrdU: 5-Bromodeoxyuridine, DCFH-DA: 2',7'-dichlorofluorescein-diacetate, DAPI: 4',6-diamidino-2'-phenylindole.
Silencing TREK-1 reduces the protective effect of siCXCR2 on neurons
Figures 6a and b show that TREK-1 expression increased significantly after CXCR2 was silenced (P < 0.001). Figures 6c and d display that the protein expression of Bcl-2 increased after CXCR2 was silenced (P < 0.001). The protein expression levels of Bax, p53, beclin-1, and LC3 II/LC3 I in the IL-1b+siCXCR2 group were downregulated (P < 0.001). Figure 6e-g shows the successful construction of overexpressed CXCR2 and silenced TREK-1 plasmid (P < 0.001). To further prove the relationship between TREK-1 and CXCR2, we overexpressed CXCR2 and silenced TREK-1. Figure 6h displays that at the mRNA level, CXCR2 expression did not change significantly after TREK-1 was silenced. Meanwhile, TREK-1 expression decreased significantly after CXCR2 was overexpressed (P < 0.05). In Figure 6i and j, TUNEL and EdU staining results showed that CXCR2 overexpression inhibited IL-1b-induced apoptosis and enhanced cell proliferation (P < 0.001), and TREK-1 silencing promoted apoptosis (P < 0.01) and inhibited cell proliferation (P < 0.001).

- Silencing of TREK-1 reduces the protective effect of siCXCR2 on neuronal cells. (a and b) Relative protein expression of TERK-1 after CXCR2 silencing. (c and d) Relative protein expression of Bcl-2, Bax, p53, LC3 II/LC3 I, and beclin-1. (e) At the RNA level, the efficiency of silencing TREK-1 and overexpressing CXCR2 was validated. (f and g) At the protein level, the efficiency of silencing TREK-1 and overexpressing CXCR2 was validated. (h) Relative mRNA expression of CXCR2 and TREK-1. (i and j) TUNEL and EdU-positive cells after different treatments. Scale bar=100 μm. Objective: 200×. n = 3. ns: No significant difference, ✶ P < 0.05, ✶✶ P < 0.01, ✶✶✶ P < 0.001. TUNEL: terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling, EdU: 5-Ethynyl-2'-deoxyuridine, TREK-1: TWIK-related K+ channel 1, CXCR2: C-X-C motif chemokine receptor, Bcl-2: B-cell lymphoma-2, BAX: Bcl-2-associated X protein, LC3: Light chain 3, mRNA: Messenger RNA.
DISCUSSION
Epilepsy is a common and often chronic neurological disorder.[18] The CNS inflammation caused by brain tissue injury, stroke, and infection plays a key role in the occurrence of epilepsy.[19] One of the most significant inflammatory mediators, proinflammatory cytokines are involved in both neuroinflammation and epilepsy.[19,20] TNF-a, IL-1b, and IL-6 are among the pro-inflammatory cytokines that are raised in the CNS as a result of microglial spark. These findings indicate the occurrence of neuroinflammation. Microglia are primary cells activated by neuroinflammation.[21-23] In this study, the levels of proinflammatory cytokines increased after epilepsy in vitro and in vivo. However, epileptic inflammation was relieved after CXCR2 was silenced.
Mesitemporal lobe sclerosis in epileptic patients is the most established lesion, characterized by loss of neurons in specific hippocampal subregions, burst sprouting of collateral axis, synaptic recombination of neural circuits, and functional and structural alterations of glial cells.[24] Following seizures, research on animal models of epilepsy consistently demonstrated a drop in p62 protein levels and an increase in the LC3 II to LC3 I ratio.[25,26] The present work also found that LC3 expression increased in the animal model of epilepsy. In addition, autophagy levels increased after cell inflammation was induced by IL-1b. Seizures cause a dysregulation of the connection between the apoptosis-related proteins beclin-1 and Bcl-2.[25] An experimental investigation revealed that 48 hours after seizures, rats’ levels of Bcl-2 dropped while those of beclin-1 and LC3 rose. This finding suggests that autophagy is activated after epilepsy.[25] In addition, inflammation of the CNS and brain damage, including seizure-causing damage, promote the release of ROS and active nitrogen. In the current work, the intracellular ROS levels were measured by fluorescent staining, and the same results were obtained.[27] Combining these results, the present research also found that epilepsy promotes the occurrence of cellular inflammation, apoptosis, and autophagy.
Given that CXCR2 and TREK-1 play an important role in epilepsy,[8,28,29] their relationship was further explored. This study found that TREK-1 may act as the downstream of CXCR2 and affect the occurrence of epilepsy. By silencing or overexpressing CXCR2 and silencing TREK-1, we found that the change in TREK-1 expression level could not cause the change in CXCR2 level. In addition, TREK-1 levels increased after CXCR2 silencing, thereby interfering with the apoptosis and autophagy in the epilepsy model and alleviating the occurrence of epilepsy.
This study has many limitations. First, only the HT22 cell line was used in the in vitro experiments. In future research, additional cell lines should be used to confirm the present results. In addition, no clinical samples were utilized. Possible signaling pathways were also not explored. In future in-depth exploration, clinical samples should be used to enrich sample types. Possible mechanisms should also be investigated.
SUMMARY
This study found that CXCR2 silencing may upregulate TREK-1, inhibit the autophagy of hippocampal neurons in epileptic mice, and reduce programmed cell death, thus playing a neuroprotective role to treat epilepsy. In vitro experiments at somatic and molecular levels are needed to further study the underlying mechanism.
AVAILABILITY OF DATA AND MATERIALS
The datasets used and/or analyzed during the current study were available from the corresponding author on reasonable request.
ABBREVIATIONS
BAX: Bcl-2-associated X protein
Bcl-2: B-cell lymphoma-2
BrdU: 5-Bromodeoxyuridine
CCK-8: Cell counting kit-8
CNS: Central nervous system
CXCR2: C-X-C motif chemokine receptor
DAPI: 4',6-diamidino-2'-phenylindole
EdU: 5-Ethynyl-2'-deoxyuridine
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
IL: Interleukin
LC3: Light chain 3
mNSS: Modified neurological severity score
PBS: Phosphate-buffered saline
qRT-PCR: Quantitative real-time polymerase chain reaction
RIPA: Radioimmunoprecipitation assay
ROS: Reactive oxygen species
SPF: Specific pathogen free
STR: Short tandem repeat
TNF-α: Tumor necrosis factor-alpha
TREK-1: TWIK-related K+ channel 1
TUNEL: Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling
AUTHOR CONTRIBUTIONS
HC and QNS: Designed the study; all authors conducted the study; WZW and TTG: Collected and analyzed the data; DQF and QC: Participated in drafting the manuscript, and all authors contributed to critical revision of the manuscript for important intellectual content. All authors gave final approval of the version to be published. All authors participated fully in the work, took public responsibility for appropriate portions of the content, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or completeness of any part of the work were appropriately investigated and resolved. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Heilongjiang University of Chinese Medicine. The study was approved by the Institutional Animal Care and Use Committee of Heilongjiang University of Chinese Medicine (HLJU-20220934). Informed consent to participate is not required, as this study does not involve human subjects.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Not applicable.
References
- The metabolic basis of epilepsy. Nat Rev Neurol. 2022;18:333-47.
- [CrossRef] [PubMed] [Google Scholar]
- Cell death: A review of the major forms of apoptosis, necrosis and autophagy. Cell Biol Int. 2019;43:582-92.
- [CrossRef] [PubMed] [Google Scholar]
- Balancing autophagy for a healthy heart. Curr Opin Physiol. 2018;1:21-6.
- [CrossRef] [PubMed] [Google Scholar]
- MiR-181b inhibits P38/JNK signaling pathway to attenuate autophagy and apoptosis in juvenile rats with kainic acid-induced epilepsy via targeting TLR 4. CNS Neurosci Ther. 2019;25:112-22.
- [CrossRef] [PubMed] [Google Scholar]
- Mechanism of cell death pathways in status epilepticus and related therapeutic agents. Biomed Pharmacother. 2022;149:112875.
- [CrossRef] [PubMed] [Google Scholar]
- TREK-1 inhibition promotes synaptic plasticity in the prelimbic cortex. Exp Neurol. 2024;373:114652.
- [CrossRef] [PubMed] [Google Scholar]
- Antidepressive and anxiolytic effects of ostruthin, a TREK-1 channel activator. PLoS One. 2018;13:e0201092.
- [CrossRef] [PubMed] [Google Scholar]
- Regulation of TWIK-related K(+) channel 1 in the anterior hippocampus of patients with temporal lobe epilepsy with comorbid depression. Epilepsy Behav. 2021;121:108045.
- [CrossRef] [PubMed] [Google Scholar]
- The two-pore domain potassium channel TREK-1 promotes blood-brain barrier breakdown and exacerbates neuronal death after focal cerebral ischemia in mice. Mol Neurobiol. 2022;59:2305-27.
- [CrossRef] [PubMed] [Google Scholar]
- The effect of CXCR2 inhibition on seizure activity in the pilocarpine epilepsy mouse model. Brain Res Bull. 2017;134:91-8.
- [CrossRef] [PubMed] [Google Scholar]
- CXCR2 chemokine receptor-a master regulator in cancer and physiology. Trends Mol Med. 2024;30:37-55.
- [CrossRef] [PubMed] [Google Scholar]
- Inhibition of CXCR2 as a therapeutic target for chronic post-surgical pain: Insights from animal and cell models. Cytojournal. 2024;21:28.
- [CrossRef] [PubMed] [Google Scholar]
- Functional defect of peripheral neutrophils in mice with induced deletion of CXCR2. Genesis. 2013;51:587-95.
- [CrossRef] [PubMed] [Google Scholar]
- Spatiotemporal ablation of CXCR2 on oligodendrocyte lineage cells: Role in myelin repair. Neurol Neuroimmunol Neuroinflamm. 2015;2:e174.
- [CrossRef] [PubMed] [Google Scholar]
- Dingxian pill alleviates hippocampal neuronal apoptosis in epileptic mice through TNF-a/TNFR1 signaling pathway inhibition. J Ethnopharmacol. 2024;334:118579.
- [CrossRef] [PubMed] [Google Scholar]
- Effects of long-term vagus nerve electrical stimulation therapy on acute cerebral infarction and neurological function recovery in post MCAO mice. Oxid Med Cell Longev. 2022;2022:8131391.
- [CrossRef] [PubMed] [Google Scholar]
- A phosphodiesterase 4 (PDE4) inhibitor, amlexanox, reduces neuroinflammation and neuronal death after pilocarpine-induced seizure. Neurotherapeutics. 2024;21:e00357.
- [CrossRef] [PubMed] [Google Scholar]
- Interleukin-1 type 1 receptor/Toll-like receptor signalling in epilepsy: The importance of IL-1beta and high-mobility group box 1. J Intern Med. 2011;270:319-26.
- [CrossRef] [PubMed] [Google Scholar]
- Neuroinflammatory pathways as treatment targets and biomarkers in epilepsy. Nat Rev Neurol. 2019;15:459-72.
- [CrossRef] [PubMed] [Google Scholar]
- Neuroinflammation pathways: A general review. Int J Neurosci. 2017;127:624-33.
- [CrossRef] [PubMed] [Google Scholar]
- Inflammatory response in the CNS: Friend or foe? Mol Neurobiol. 2017;54:8071-89.
- [CrossRef] [PubMed] [Google Scholar]
- The role of inflammation in the development of epilepsy. J Neuroinflammation. 2018;15:144.
- [CrossRef] [PubMed] [Google Scholar]
- Changes in hippocampal GABAA/cBZR density during limbic epileptogenesis: Relationship to cell loss and mossy fibre sprouting. Neurobiol Dis. 2011;41:227-36.
- [CrossRef] [PubMed] [Google Scholar]
- Alterations of apoptosis and autophagy in developing brain of rats with epilepsy: Changes in LC3, P62, Beclin-1 and Bcl-2 levels. Neurosci Res. 2018;130:47-55.
- [CrossRef] [PubMed] [Google Scholar]
- Kainic acid induces early and transient autophagic stress in mouse hippocampus. Neurosci Lett. 2007;414:57-60.
- [CrossRef] [PubMed] [Google Scholar]
- Inflammation and reactive oxygen species as disease modifiers in epilepsy. Neuropharmacology. 2020;167:107742.
- [CrossRef] [PubMed] [Google Scholar]
- Endothelial Cdk5 deficit leads to the development of spontaneous epilepsy through CXCL1/CXCR2-mediated reactive astrogliosis. J Exp Med. 2020;217:e20180992.
- [CrossRef] [PubMed] [Google Scholar]
- CXCL1-CXCR1/2 signaling is induced in human temporal lobe epilepsy and contributes to seizures in a murine model of acquired epilepsy. Neurobiol Dis. 2021;158:105468.
- [CrossRef] [PubMed] [Google Scholar]
