Translate this page into:
The effect of Wilms tumor 1-associated protein on ferroptosis and immune escape in non-small-cell lung cancer by mediating N6-methyladenosine modification of Twist1
*Corresponding author: Lijuan Zou, Department of Radiotherapy Oncology, The Second Affiliated Hospital of Dalian Medical University, Dalian, China. zoulijuan63@126.com
-
Received: ,
Accepted: ,
How to cite this article: Yang X, Li J, Li Y, Li M, Peng L, Zhao L, et al. The effect of Wilms tumor 1-associated protein on ferroptosis and immune escape in non-small-cell lung cancer by mediating N6-methyladenosine modification of Twist1. CytoJournal. 2026;23:10. doi: 10.25259/Cytojournal_114_2025
Abstract
Objective:
Non-small-cell lung cancer (NSCLC) is one of the most frequently occurring and aggressive cancers globally, but its complex molecular mechanisms remain only partially understood. This study investigated the effects of Wilms tumor 1-associated protein (WTAP) on NSCLC cell ferroptosis and immune escape through N6-methyladenosine (m6A) modification of twist family BHLH transcription factor 1 (Twist1).
Material and Methods:
Western blot and reverse transcription-quantitative polymerase chain reaction were used to assess Twist1 expression in NSCLC cell lines and its circular structure. Small interfering RNAs targeting Twist1 and WTAP were transfected into H2170 cells, and their effects on cell viability, apoptosis, ferroptosis markers (reactive oxygen species [ROS], malondialdehyde [MDA], and Fe2+), and immune escape were evaluated using cell counting kit-8, flow cytometry, terminal deoxynucleotidyl transferase dUTP Nick-End labeling, ROS staining, and enzyme-linked immunosorbent assay. Co-culture with CD8+ T cells was employed to assess cytotoxicity and exhaustion marker expression (Lymphocyte activation gene-3, Programmed cell death protein 1, and T-cell immunoreceptor with Ig and ITIM domains). Magna methylated RNA immunoprecipitation, photo-activatable ribonucleoside-enhanced cross-linking and immunoprecipitation, and treatment with the methylation inhibitor 3-Deazaneplanocin A (3-DAA) confirmed the m6A modification of Twist1 and WTAP’s regulatory role.
Results:
Twist1 was dramatically elevated in the NSCLC cell lines (P < 0.05). Knockdown of Twist1 inhibited NSCLC cell viability; promoted apoptosis; increased ROS, MDA, and Fe2+ levels; enhanced the cytotoxicity of CD8+ T cells; and reduced the expression of exhaustion markers (P < 0.05). These effects were partially reversed by the ferroptosis inhibitor Fer-1. WTAP expression increased in the NSCLC cells, and its knockdown markedly reduced the m6A modification and expression of Twist1 (P < 0.05). Furthermore, overexpression of Twist1 partially reversed the inhibitory effects of WTAP knockdown on NSCLC cell proliferation, ferroptosis, and immune escape (P < 0.05).
Conclusion:
Twist1 is highly expressed in NSCLC. It promotes NSCLC progression by enhancing ferroptosis and immune escape. WTAP-mediated m6A methylation plays a critical role in regulating Twist1 expression. The WTAP/Twist1 axis may serve as a potential therapeutic target for NSCLC.
Keywords
Ferroptosis
N6-methyladenosine modification
Non-small-cell lung cancer
Twist1
Wilms tumor 1-associated protein
INTRODUCTION
Lung cancer (LC), with approximately 2.2 million new cases and 1.8 million deaths, was the second most prevalent cancer (11.4% of total cases) and the first contributor (18% of total deaths) to cancer-associated deaths in 2020.[1] As a highly heterogeneous disorder, LC is broadly divided into non-small-cell LC (NSCLC) and small-cell LC, which account for 85% and 15% of total LC diagnoses, respectively.[2] At present, therapeutic modalities for NSCLC consist of surgery, immunotherapy, targeted therapy, chemotherapy, and radiotherapy, either alone or in combination.[3] However, the prognosis and curative outcomes of NSCLC remain poor, underscoring the need to further explore its complex molecular underpinnings and identify effective treatment strategies.[4] Fundamentally, the diverse mechanisms of immune evasion facilitate the transition of precursor lesions to invasive stages, thereby promoting progression from early lesions to metastatic cancer.[5] Ferroptosis, an iron-dependent programmed death, substantially affects tumorigenesis and progression, and inducing ferroptosis in NSCLC can curb tumor progression in vivo and in vitro.[6] Therefore, dissecting the molecular mechanisms underpinning ferroptosis and immune escape in NSCLC is essential.
Twist1 is a novel oncogene in NSCLC that stimulates thrombospondin-2 to accelerate the malignant progression of NSCLC by sponging microRNA (miR)-584-5p.[7] The elevated Twist1 level in NSCLC is prominently interrelated with lymph node metastasis and large tumor size.[8] Given Twist1’s ability to regulate gene expression networks, it may influence the balance between tumor cell death and immune tolerance by modulating key ferroptosis markers and immune checkpoint molecules. Deep understanding of the mechanisms by which Twist1 contributes to ferroptosis and immune escape in NSCLC may provide new insights into tumor biology and offer potential therapeutic targets to enhance antitumor immune responses. However, the functions of Twist1 in tumor ferroptosis and immune escape have not been elucidated.
N6-methyladenosine (m6A) modification is abundant in circular RNAs and participates in their biogenesis, stability, and translation, and m6A modification of RNA can serve as a biomarker that plays dual roles of timely screening and treatment in LC.[9] Specifically, m6A methylation modulates NSCLC cell cycle, apoptosis, proliferation, invasion, and migration, and it involves the participation of an array of methyltransferases, recognition proteins, and demethylases.[10] Bioinformatics analysis has revealed multiple m6A modification sites in Twist1 and its binding to Wilms tumor 1-associated protein (WTAP). As an m6A methyltransferase, WTAP is overexpressed in numerous cancers and identified as a promising biomarker for predicting tumor progression due to its involvement in alternative splicing, m6A methylation, and cell cycle modulation.[11] Notably, an increased WTAP level is associated with poor NSCLC prognosis, highlighting the prognostic and therapeutic potential of WTAP in NSCLC.[12]
In this context, the hypothesis that WTAP may manipulate m6A modification of Twist1 to affect ferroptosis and immune escape in NSCLC has been proposed. This present study was implemented to validate the hypothesis above, reveal the molecular mechanisms underlying NSCLC ferroptosis and immune escape, and explore novel potent targets for NSCLC treatment.
MATERIAL AND METHODS
Cell culture
NSCLC cell lines (H2170, CL-0394) and normal human bronchial epithelial (HBE) cells (CP-H009) (all from Procell, Wuhan, Hubei, China) were cultured in Roswell Park Memorial Institute-1640 medium (12633020, Gibco, Grand Island, NY, the USA) composed of 1% antibiotic and 10% fetal bovine serum (Thermo Fisher Scientific, Wilmington, DE, the USA) at 37°C in a 5% CO2 incubator (CB 260, Binder, Tuttlingen, Germany). The cells used in this study had all undergone short tandem repeat authentication, and the results of mycoplasma testing were negative.
Cell transfection
Cell transfection was implemented with the following expression vectors: Small interfering RNA (siRNA) targeting WTAP (si-WTAP-1: GGAGGTAGTGGTTACGTAAAT, si-WTAP-2: ATGG CAAGAGAGATGAGTTAATT, and si-WTAP-3: GCAA GAGTGTACTACTCAAAT), WTAP overexpression vector oe-WTAP, siRNA targeting Twist1 (si-Twist1-1: UGGAAACAAUGACAUUUCUCU, si-Twist1-2: ATCGGTCTAAAGTGCTAATTT, and si-Twist1-3: ACAAUG ACAUUUCUCUAAAUU). After lentiviral transfection reagents were co-transfected into HEK293T for 48 h, the viral titer was determined using p24 enzyme-linked immunosorbent assay (ELISA) kits (Cell Biolabs, San Diego, CA, the USA). Subsequently, NSCLC cells were infected with the prepared lentiviral particles for 24 h. The stably infected cell lines were screened with puromycin following 48-h culture, and the transfection effect was validated for subsequent experiments.
Reverse transcription–quantitative polymerase chain reaction
Total RNA was isolated from cells using the Trizol reagent (R1100, Solarbio, Beijing, China) in accordance with the manufacturer’s protocol. RNA concentration and purity were subsequently assessed with a NanoDrop spectrophotometer (Thermo Fisher Scientific). The extracted RNA was digested with RNase R (2 U/μg, Geneseed, Guangzhou, Guangdong, China), followed by reverse transcription using a first-strand cDNA synthesis kit (D7168S, Beyotime, Shanghai, China), to identify and evaluate the circular characteristics of Twist1. Quantitative real-time polymerase chain reaction (RT-qPCR) was conducted using SYBR GreenMix (Takara, Tokyo, Japan) on an ABI 7300 real-time PCR system (Foster City, CA, the USA), and each sample was tested in triplicate. Relative gene expression levels were calculated using the 2^–ΔΔCt method,[13] and β-actin served as the endogenous control. The primer sequences applied in this study are shown in detail in Table 1.
| Primer name | Primer sequences (5’-3’) |
|---|---|
| hum-Twist1-F | CCGTTGGGCGCTTTCTTTTT |
| hum-Twist1-R | GCCAGCTTGAGGGTCTGAAT |
| hum-LAG3-F | TGACTGGAGACAATGGCGAC |
| hum-LAG3-R | TGCCATCAGCACTCTGAGGA |
| hum-PD1-F | TGGATTTCCAGTGGCGAGAG |
| hum-PD1-R | ACCTTGGGACCGTAGGATGT |
| hum-TIGIT-F | AGCACCAAGGGGATGTTGAG |
| hum-TIGIT-R | AGCACAAAGTCGTCAGGGAG |
| hum-WTAP-F | GCTTCTGCCTGGAGAGGATTCAA |
| hum-WTAP-R | ATCTTCGGTTGTGTTGCCCTC |
| Hum-GPX4-F | AATTCGCAGCCAAGGACATC |
| hum-GPX4-R | AGGCCAGGATTCGTAAAACCA |
| hum-β-Actin-F | ACCTTCTACAATGAGCTGCG |
| hum-β-Actin-R | CCTGGATAGCAACGTACATGG |
WTAP: Wilms tumor 1-associated protein, LAG3: Lymphocyte activation gene-3, PD1: Programmed cell death protein 1, TIGIT: T cell immunoreceptor with Ig and ITIM domains, A: Adenine, T: Thymine, G: Guanine, C: Cytosine
Western blot
Proteins were extracted using the radio-immunoprecipitation assay buffer and quantified via bicinchoninic acid assay. Equal protein amounts were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to polyvinylidene fluoride membranes, and blocked with 5% skim milk. The membranes were incubated overnight at 4°C with anti-Twist1 (1:1000, ab50887, Abcam) followed by horseradish peroxidase-conjugated secondary antibody (1:1000, ab6728, Abcam). Bands were visualized using enhanced chemiluminescence (C520045, Sangon Biotech, Shanghai, China) and analyzed with ImageJ software (Fiji, NIH, Bethesda, Maryland, the USA).
Cell counting kit-8 (CCK-8) assay
Each well was seeded with 100 μL of the dilution of the cell mixture (1 × 106 cells/mL) and 10 μL of CCK-8 solution (CA1210, Solarbio, Beijing, China). The absorbance at 450 nm was subsequently determined with the help of a microplate reader (Model 680; Bio-Rad, Hercules, California, the USA) after incubation for different times in a CO2 incubator.
Flow cytometry
Flow cytometry was utilized to assess cell apoptosis. For apoptosis assessment, cells were collected by centrifugation after trypsin detachment, resuspended in binding buffer, and incubated in the dark at ambient temperature for 15 min with 5 μL of annexin V-fluorescein isothiocyanate and 5 μL of propidium iodide (C1062S, Beyotime, Shanghai, China), followed by detection on a flow cytometer (FACSCanto II, BD Biosciences, Franklin Lakes, New Jersey, the USA).
Determination of reactive oxygen species (ROS) contents
The ROS contents in the cells were measured using 2’,7’-dichlorofluorescein diacetate (DCFH-DA) probes (4091-99-0, Sigma-Aldrich, St. Louis, Missouri, the USA). The collected cells were centrifuged, and the supernatant was incubated with 10 μmol/L DCFH-DA probes for 30 min at 37°C in the dark. DCFH-DA was oxidized to highly fluorescent DCFH, which emits green fluorescence in the cytoplasm, which was captured using an Olympus (Tokyo, Japan) IX51 fluorescence microscope. Fluorescence intensity was quantitatively analyzed using ImageJ software (Fiji, NIH, Bethesda, Maryland, the USA).
Measurement of malondialdehyde (MDA) and Fe2+
The contents of MDA and Fe2+ were measured using specific assay kits. For MDA (CS0260, Sigma-Aldrich, St. Louis, Missouri, the USA), samples were heated with MDA detection liquid at 100°C for 15 min and centrifuged. Then, the absorbance of the supernatant was measured at 532 nm by a microplate reader (SpectraMax i3x, Molecular Devices, San Jose, California, the USA). Fe2+ content (E-BC-K773-M, ELabscience, Wuhan, China) was measured by incubating cell samples with assay buffer and iron ion probes at 25°C in the dark, followed by absorbance measurement at 593 nm by a microplate reader (SpectraMax i3x, Molecular Devices, San Jose, California, the USA).
Quantification analysis of m6A
The quality of extracted total RNA was assessed, and the m6A content in tissues or cells was quantified with N6-methyladenosine RNA (m6A RNA) methylation quantification kits (ab185912, Abcam, Cambridge, the UK). Specifically, the solution was mixed by gently tilting from side to side, and the relevant solution was supplemented to each well, followed by m6A RNA capture. A signal was detected when the positive control wells turned medium blue in color. Each well was supplemented with 100 μL of the termination solution to terminate the enzyme reaction, and the absorbance at 450 nm was determined by a microplate reader (Model 680; Bio-Rad, Hercules, California, the USA).
Methylated RNA immunoprecipitation
Total RNA was extracted and purified by PolyATtract® mRNA Isolation Systems (A-Z5300, A&D Technology, Beijing, China), followed by the removal of DNA contamination. After quantification, RNA fragmentation was performed by heating with the fragmentation buffer provided in the Magna methylated RNA immunoprecipitation (Me-RIP) m6A kits (Merck Millipore, Billerica, MA, the USA) at 94°C for 5 min. The fragmented RNA was then cooled and purified. Next, the anti-m6A antibody was mixed with magnetic beads, incubated at room temperature for 15 min, and washed afterward. The fragmented RNA was then incubated with the antibody-bead complex at 4°C with rotation for about 2 h to complete the immunoprecipitation. Subsequently, the beads were washed multiple times with wash buffer to remove nonspecifically bound RNA. Then, the bound RNA was released through proteinase K digestion and purified. The immunoprecipitated RNA was used for qPCR or sequencing analysis, and the input RNA was retained as a control.
Photo-activatable ribonucleoside-enhanced cross-linking and immunoprecipitation
NSCLC cells were subjected to 14 h incubation with 200 mM 4-thiopyridine (148202, Sigma-Aldrich, St. Louis, Missouri, the USA) and cross-linked by ultraviolet radiation at 0.4 J/cm2 an irradiation wavelength of 365 nm. Subsequent to lysis, IP reactions were implemented at 4°C by utilizing the WTAP antibody (ab195380, Abcam, Cambridge, the UK). Proteins were then removed through proteinase K digestion, and the expression of Twist1 in the extracted RNA was determined through RT-qPCR.
Isolation of CD8+ T cells
Human peripheral blood mononuclear cells (HUMiCell-i010) were purchased from Cellverse Co., Ltd. (Shanghai, China). CD8+ T cells were then isolated using a magnetic separation kit (HY-K0351, MedChemExpress, South Brunswick Township, New Jersey, the USA) in accordance with the manufacturer’s instructions. A negative selection strategy was employed; specifically, non-CD8+ cells were labeled with antibodies and magnetic beads and subsequently removed, leaving untouched CD8+ T cells. All procedures were conducted under sterile conditions. Then, cell counting and purity assessment were performed to confirm separation efficiency, and high-purity human CD8+ T cells were obtained for the subsequent experiments.
Cytotoxicity assay
CD8+ T-cell-mediated cytotoxicity was evaluated with CytoTox 96 non-radioactive cytotoxicity assay kits (G1780, Promega, Madison, WI, the USA). CD8+ T cells were co-cultured with H2170 or A549 cells. The obtained supernatant was supplemented with lactate dehydrogenase (LDH) substrate solution, and the reaction was terminated after 30 min, followed by absorbance measurement at 490 nm.
Statistical analysis
Statistical analysis was performed with the help of GraphPad Prism 8 software (GraphPad Software, Inc., San Diego, California, the USA), and all data were depicted as mean ± standard deviation. The t-test was implemented for two-group comparisons, and one-way analysis of variance was utilized for multiple-group comparisons, followed by Tukey’s post-hoc test. P < 0.05 indicated a statistical difference.
RESULTS
Twist1 was highly expressed in NSCLC
RT-qPCR and Western blot were utilized to determine the expression levels of Twist1 in NSCLC. The NSCLC cell lines (H2170) exhibited elevated Twist1 expression relative to the HBE cells ([Figure 1a-c], P < 0.001).
- Twist1 expression is elevated in NSCLC. (a) RT-qPCR to determine Twist1 expression in HBE and NSCLC cells (H2170). (b and c) Western blot to detect the expression of Twist1 in HBE and NSCLC (H2170) cells. n = 6, ✶✶✶P < 0.001. NSCLC: Non-small-cell lung cancer, RT-qPCR: Quantitative real-time polymerase chain reaction, HBE: Human bronchial epithelial.
Silencing of Twist1 accelerated ferroptosis of NSCLC cells
Low-expression vectors (si-Twist1-1, si-Twist1-2, and si-Twist1-3) were introduced into H2170 cells to further clarify the function of Twist1 in NSCLC. RT-qPCR analysis revealed that these vectors significantly downregulated Twist1 expression, with si-Twist1-3 showing the most pronounced effect [Figure 2a], leading to its selection for the subsequent experiments. The relationship between Twist1 and ferroptosis was investigated by treating H2170 cells with si-Twist1 alone or in combination with the ferroptosis inhibitor Fer-1. CCK-8 assays and flow cytometry demonstrated that si-Twist1 transfection markedly reduced cell viability and increased apoptosis in the NSCLC cells ([Figure 2b-d], P < 0.001). Moreover, ROS levels were markedly elevated in the cells transfected with si-Twist1 ([Figure 2e and f], P < 0.001). The ELISA results showed that knockdown of Twist1 substantially enhanced the levels of MDA and Fe2+. Compared with the si-Twist1 group, co-treatment with si-Twist1 and Fer-1 significantly reduced the levels of MDA and Fe2+ (P < 0.001, [Figure 2g and h]). These findings indicate that the silencing of Twist1 promotes ferroptosis in NSCLC cells.
- Twist1 silencing facilitates ferroptosis of NSCLC cells. (a) RT-qPCR to measure Twist1 expression in H2170 cells. (b) CCK-8 assay to assess cell viability. (c and d) TUNEL staining to evaluate cell apoptosis; scale bar: 100 μm. (e and f) DCFH-DA molecular probes to detect ROS production; scale bar: 50 μm. (g and h) Kits to measure the expression levels of MDA, Fe2+. n = 6, ns: No significant difference. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. NSCLC: Non-small-cell lung cancer, RT-qPCR: Quantitative real-time polymerase chain reaction, CCK-8: Cell counting kit-8, TUNEL: Terminal deoxynucleotidyl transferase dUTP Nick-End labeling, ROS: Reactive oxygen species, MDA: Malondialdehyde.
Downregulation of Twist1 inhibited immune escape in NSCLC
Next, we co-cultured human CD8+ T cells with H2170 cells treated with either si-Twist1 or si-Twist1 combined with Fer-1. Alterations in immune escape were evaluated. LDH assays, CCK-8 assays, and flow cytometry revealed that transfection with si-Twist1 alone enhanced CD8+ T-cell cytotoxicity, increased the viability of CD8+ T cells, and reduced apoptosis ([Figure 3a-d], P < 0.001). Moreover, we assessed the role of si-Twist1 and Fer-1 in the expression of CD8+ T-cell exhaustion markers (Lymphocyte activation gene-3 [LAG3], programmed cell death protein 1 [PD1], and T-cell immunoreceptor with Ig and ITIM domains [TIGIT]) through qRT-PCR. Relative to the si-NC group, si-Twist1 treatment substantially reduced the mRNA levels of LAG3, PD1, and TIGIT. Furthermore, compared with the si-Twist1-only group, co-treatment with si-Twist1 and Fer-1 significantly increased the mRNA expression of LAG3, PD1, and TIGIT (P < 0.01, [Figure 3e-g]).
- Twist1 silencing hinders the immune escape of NSCLC cells. (a) Evaluation of CD8+ T cytotoxicity using LDH assay. (b) Assessment of the activity of CD8+ T cells using CCK-8 assay. (c and d) Assessment of CD8+ T-cell apoptosis by flow cytometry. (e-g) Measurement of the expression of LAG3, PD1, and TIGIT through qRT-PCR. n = 6, ns: No significant difference. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. NSCLC: Non-small-cell lung cancer, LDH: Lactate dehydrogenase, CCK-8: Cell counting kit-8, LAG3: Lymphocyte activation gene-3, PD1: Programmed cell death protein 1, TIGIT: T-cell immunoreceptor with Ig and ITIM domains, RT-qPCR: Quantitative real-time polymerase chain reaction.
WTAP regulated m6A modification of Twist1 and upregulated its expression in NSCLC
qRT-PCR analysis further revealed that WTAP mRNA levels were considerably higher in the H2170 cells compared with those in the HBE cells (P < 0.001) [Figure 4a]. Three WTAP-targeting siRNA constructs (si-WTAP-1, si-WTAP-2, and si-WTAP-3) were transfected into H2170 cells to further investigate the role of WTAP in NSCLC. RT-qPCR showed that all three constructs markedly reduced WTAP expression, with si-WTAP-3 exhibiting the most pronounced knockdown effect [Figure 4b]; therefore, it was selected for the subsequent experiments. Me-RIP analysis demonstrated that the m6A modification level of Twist1 was significantly elevated in the H2170 cells compared with that in the HBE cells (P < 0.001, [Figure 4c]). Subsequently, H2170 cells were treated with either dimethyl sulfoxide (DMSO) or the methylation inhibitor 3-DAA. As shown in Figure 4d, 3-DAA treatment significantly reduced Twist1 mRNA levels compared with the DMSO control (P < 0.001). The effect of WTAP knockdown on Twist1 mRNA levels was also examined. Figure 4e indicates that si-WTAP transfection significantly decreased Twist1 mRNA expression (P < 0.001). Photo-activatable ribonucleoside-enhanced cross-linking and immunoprecipitation (PAR-CLIP) analysis further confirmed that Twist1 expression was significantly reduced in the si-WTAP group (P < 0.01, [Figure 4f]). These data indicate that WTAP-driven m6A modification is essential for modulating Twist1 expression in NSCLC.
- WTAP promotes Twist1 stability through m6A methylation modification. (a) qRT-PCR is used to detect the expression of WTAP in NSCLC cells. (b) qRT-PCR verifies the transfection efficiency of si-WTAP. (c) Me-RIP assay is performed to determine the m6A level of Twist1. (d) RT-PCR is used to assess the expression level of Twist1 after 3-DAA treatment. (e) RT-PCR is employed to evaluate Twist1 expression after WTAP knockdown. (f) A PAR-CLIP experiment is conducted to assess the interaction between WTAP and Twist1. n = 6, ns: No significant difference. ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. WTAP: Wilms tumor 1-associated protein, NSCLC: Non-small-cell lung cancer, RT-qPCR: Quantitative real-time polymerase chain reaction, PAR-CLIP: Photo-activatable ribonucleoside-enhanced cross-linking and immunoprecipitation.
WTAP regulated ferroptosis in NSCLC through Twist1
To investigate the specific role of WTAP in NSCLC, we transfected si-WTAP into H2170 cells either alone or in combination with oe-Twist1. The results showed that Twist1 levels were considerably higher in the si-WTAP + oe-Twist1 group compared with the si-WTAP + oe-NC group ([Figure 5a], P < 0.001). Subsequently, the relationship between si-WTAP or oe-Twist1 and ferroptosis in NSCLC was explored. CCK-8 assay indicated that si-WTAP transfection significantly decreased the viability of H2170 cells (P < 0.001), and co-transfection with si-WTAP and oe-Twist1 significantly restored cell viability compared with the si-WTAP + oe-NC group (P < 0.001, [Figure 5b]). Terminal deoxynucleotidyl transferase dUTP Nick-End labeling staining was used to further assess the effect of si-WTAP on apoptosis in H2170 cells. The results showed that si-WTAP transfection markedly increased apoptosis, whereas co-transfection with oe-Twist1 significantly decreased the apoptosis level (P < 0.001, [Figure 5c and d]). ROS fluorescence staining and ELISA demonstrated that si-WTAP transfection significantly elevated ROS, MDA, and Fe2+ levels in H2170 cells (P < 0.001), whereas these levels were markedly reduced in the si-WTAP + oe-Twist1 co-transfection group compared with the si-WTAP alone group (P < 0.01, [Figure 5e-h]). As shown in Figure 5i, transfection with si-WTAP markedly reduced the mRNA expression level of GPX4 in H2170 cells. Compared with the si-WTAP + oe-NC group, co-transfection with si-WTAP and oe-Twist1 substantially increased the mRNA level of GPX4.
- WTAP increases Twist1 stability to regulate NSCLC cell ferroptosis. (a) Twist1 expression measured by RT-qPCR. (b) Cell viability was evaluated by CCK-8. (c and d) Cell apoptosis evaluated by TUNEL staining; scale bar: 100 μm. (e and f) ROS level determined utilizing DCFH-DA molecular probes; scale bar: 50 μm. (g and h) MDA and Fe2+ levels were determined with corresponding kits. (i) Relative mRNA expression level of GPX4. n = 6, ✶✶P < 0.01, ✶✶✶P < 0.001. WTAP: Wilms tumor 1-associated protein, NSCLC: Non-small-cell lung cancer, RT-qPCR: Quantitative real-time polymerase chain reaction, CCK-8: Cell counting kit-8, ROS: Reactive oxygen species, MDA: Malondialdehyde, TUNEL: Terminal deoxynucleotidyl transferase dUTP Nick-End labeling.
WTAP inhibits immune escape in NSCLC through Twist1
Next, changes in immune escape were investigated. LDH and CCK-8 assays revealed that compared with the si-NC + oe-NC group, si-WTAP + oe-NC transfection markedly enhanced the cytotoxicity and viability of CD8+ T cells. By contrast, co-transfection with si-WTAP and oe-Twist1 significantly suppressed the cytotoxicity and viability of CD8+ T cells compared with the si-WTAP + oe-NC group (P < 0.001, [Figure 6a and b]). Flow cytometry showed that si-WTAP + oe-NC significantly reduced CD8+ T-cell apoptosis compared with si-NC + oe-NC (P < 0.001), whereas co-transfection with si-WTAP and oe-Twist1 significantly increased CD8+ T-cell apoptosis relative to si-WTAP + oe-NC (P < 0.01, [Figure 6c and d]). In addition, RT-PCR was used to assess the effects of si-WTAP or si-WTAP + oe-Twist1 on the expression of CD8+ T-cell exhaustion markers (LAG3, PD1, and TIGIT). The results showed that si-WTAP + oe-NC markedly reduced the expression of LAG3, PD1, and TIGIT compared with the si-NC + oe-NC group, whereas co-transfection with si-WTAP and oe-Twist1 substantially increased their mRNA levels compared with si-WTAP + oe-NC [Figure 6e-g].
- WTAP inhibits immune escape in NSCLC through Twist1. (a) Examination of cytotoxicity using LDH assay. (b) Viability of CD8+ T cells assessed using the CCK-8 assay. (c and d) Evaluation of CD8+ T-cell apoptosis by flow cytometry. (e-g) Expression of LAG3, PD1, and TIGIT measured by qRT-PCR. n = 6, ✶P < 0.05, ✶✶P < 0.01, ✶✶✶P < 0.001. WTAP: Wilms tumor 1-associated protein, NSCLC: Non-small-cell lung cancer, RT-qPCR: Quantitative real-time polymerase chain reaction, CCK-8: Cell counting kit-8, LAG3: Lymphocyte activation gene-3, PD1: Programmed cell death protein 1, TIGIT: T-cell immunoreceptor with Ig and ITIM domains, LDH: Lactate dehydrogenase.
DISCUSSION
This study revealed that WTAP-mediated m6A modification upregulates the expression of Twist1, thereby inhibiting ferroptosis and promoting immune escape in NSCLC, ultimately facilitating tumor progression. The findings highlight the critical role of m6A epitranscriptomic regulation in modulating tumor metabolism and immune responses and suggest a novel potential therapeutic target for NSCLC.
We confirmed that Twist1 is markedly overexpressed in NSCLC cells, a result that is consistent with those of previous studies that found that Twist1, as a key transcription factor in epithelial-mesenchymal transition (EMT), plays a crucial role in tumor metastasis, chemoresistance, and maintenance of stemness.[14-16] However, our study further revealed a novel function of Twist1 in NSCLC: it markedly suppresses ferroptosis by inhibiting the accumulation of ROS, MDA, and Fe2+. This finding aligns with those of existing literature that reported that EMT transcription factors can influence iron metabolism and lipid peroxidation, thereby modulating cellular sensitivity to ferroptosis.[17,18]
Moreover, this study demonstrated that silencing Twist1 enhances the cytotoxic activity of CD8+ T cells against tumor cells, reduces their apoptosis, and suppresses the expression of immune exhaustion markers, such as PD1, LAG3, and TIGIT, suggesting that Twist1 is involved in the regulation of tumor immune escape. Previous studies have reported a strong association between EMT activation and the formation of an immunosuppressive tumor microenvironment.[19,20] Our findings further elucidate this relationship by highlighting the role of Twist1 in promoting immune evasion from an EMT-related perspective.
Mechanistically, our Me-RIP, PAR-CLIP, and methylation inhibition assays confirmed that WTAP stabilizes Twist1 mRNA through m6A modification, thereby upregulating its expression. As a key component of the m6A methyltransferase complex, WTAP has been reported to perform oncogenic functions in various cancers, although its role in NSCLC remains unclear.[21,22] This study is the first to demonstrate that WTAP promotes ferroptosis resistance and modulates immune function in NSCLC through m6A-dependent regulation of Twist1.
The functional rescue experiments further demonstrated that Twist1 acts as a key downstream effector of WTAP. Overexpression of Twist1 partially reverses the effects of WTAP knockdown, including suppressed cell proliferation, enhanced ferroptosis, and increased immune activation. These results support the critical role of the WTAP-Twist1 axis in driving NSCLC progression.
This study has massive potential for clinical translation. With growing interest in the role of m6A modification in cancer biology, targeting WTAP or disrupting the WTAP-Twist1 interaction may be a promising therapeutic strategy for NSCLC. Combining m6A inhibitors with ferroptosis inducers or immune checkpoint inhibitors could produce synergistic antitumor effects. Furthermore, Twist1 expression levels may serve as a potential predictive biomarker for responses to ferroptosis-based therapies or immunotherapy.
Despite providing important mechanistic insights, this study has limitations. First, the experiments were primarily conducted in vitro using cell lines and lacked in vivo validation. Future studies should systematically investigate the role of the WTAP-Twist1 axis in regulating tumor growth, immune escape, and ferroptosis within animal models. Second, our analysis focused solely on the CD8+ T-cell function and did not explore the involvement of other immune cell populations within the tumor microenvironment. For example, the roles of regulatory T cells and myeloid-derived suppressor cells in this pathway warrant further investigation. Third, the study utilized only a single NSCLC cell line (H2170). Notably, expanding the research to multiple NSCLC subtypes will improve the generalizability and robustness of the findings. Last, the upstream regulatory mechanisms of WTAP remain unclear. Whether WTAP is modulated by specific transcription factors, miR, or signaling pathways remains to be elucidated in future studies.
In conclusion, our findings suggest that WTAP regulates NSCLC ferroptosis and immune escape by stabilizing Twist1 through m6A modification.
SUMMARY
The current research emphasized that WTAP elevates Twist1 expression and stability by potentiating m6A modification, thus curbing ferroptosis and fostering immune escape in NSCLC. Our findings can offer valuable insights into the mechanisms behind ferroptosis and immune escape in NSCLC and provide a theoretical basis and novel targets for the clinical treatment and management of NSCLC.
AVAILABILITY OF DATA AND MATERIALS
The data and materials that support the findings of this study are available from the corresponding author on reasonable request.
ABBREVIATIONS
CCK-8: Cell counting Kit-8
CD8+: Cluster of differentiation 8 positive
Fer-1: Ferrostatin-1
GPX4: Glutathione peroxidase 4
HBE cells: Human bronchial epithelial cells
LAG3: Lymphocyte activation gene-3
m6A: N6-methyladenosine
MDA: Malondialdehyde
MeRIP: Methylated RNA immunoprecipitation
NSCLC cells (H2170): Non-small-cell lung cancer cells, H2170
NSCLC: Non-small-cell lung cancer
oe-NC: Overexpression negative control
oe-WTAP: Overexpression WTAP
PAR-CLIP: Photo-activatable ribonucleoside-enhanced
cross-linking and immunoprecipitation
PD1: Programmed cell death protein 1
ROS: Reactive oxygen species
RT-qPCR: Reverse transcription-quantitative polymerase chain reaction
si-NC: Small interfering RNA negative control
si-Twist1: Small interfering RNA targeting Twist1
TIGIT: T-cell immunoreceptor with Ig and ITIM domains
TUNEL: Terminal deoxynucleotidyl transferase dUTP Nick-End labeling
WTAP: Wilms tumor 1-associated protein
AUTHOR CONTRIBUTIONS
XHY and JZL: Designed the research study; XHY, JZL, YYL, ML, LGP, LZ, and LJZ: Performed the research; LJZ: Collected and analyzed the data; XHY, JZL, YYL, ML, LGP, LZ, and LJZ: Have been involved in drafting the manuscript, and all authors have been involved in revising it critically for important intellectual content. All authors give final approval of the version to be published. All authors have participated sufficiently in the work to take public responsibility for appropriate portions of the content and agreed to be accountable for all aspects of the work in ensuring that questions related to its accuracy or integrity are addressed. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
Not applicable.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded from reviewers and vice versa) through an automatic online system.
FUNDING: This research was supported by Hunan Provincial Natural Science Foundation of China (grant No. 2023JJ60074); supported by the Natural Science Foundation of Changsha City (grant No. kq2208447).
References
- Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71:209-249.
- [CrossRef] [PubMed] [Google Scholar]
- Non-small cell lung cancer in China. Cancer Commun (Lond). 2022;42:937-70.
- [CrossRef] [PubMed] [Google Scholar]
- The biology and management of non-small cell lung cancer. Nature. 2018;553:446-54.
- [CrossRef] [PubMed] [Google Scholar]
- Immune escape mechanisms in non-small cell lung cancer. Cancers (Basel). 2020;12:3605.
- [CrossRef] [PubMed] [Google Scholar]
- Ferroptosis in non-small cell lung cancer: Progression and therapeutic potential on it. Int J Mol Sci. 2021;22:13335.
- [CrossRef] [PubMed] [Google Scholar]
- Circ_0079530 stimulates THBS2 to promote the malignant progression of non-small cell lung cancer by sponging miR-584-5p. Histol Histopathol. 2023;38:681-93.
- [Google Scholar]
- Hsa_circ_0079530 promotes cell proliferation and invasion in non-small cell lung cancer. Gene. 2018;665:1-5.
- [CrossRef] [Google Scholar]
- m6A modification of RNA and its role in cancer, with a special focus on lung cancer. Genomics. 2021;113:2860-9.
- [CrossRef] [PubMed] [Google Scholar]
- Implications of m6A methylation and microbiota interaction in non-small cell lung cancer: From basics to therapeutics. Front Cell Infect Microbiol. 2022;12:972655.
- [CrossRef] [PubMed] [Google Scholar]
- The RNA m6A writer WTAP in diseases: Structure, roles, and mechanisms. Cell Death Dis. 2022;13:852.
- [CrossRef] [PubMed] [Google Scholar]
- ING2-WTAP is a potential therapeutic target in non-small cell lung cancer. Biochem Biophys Res Commun. 2022;605:31-8.
- [CrossRef] [PubMed] [Google Scholar]
- TaqMan-based real-time PCR for genotyping common polymorphisms of haptoglobin (HP1 and HP2) Clin Chem. 2008;54:1908-13.
- [CrossRef] [PubMed] [Google Scholar]
- Molecular mechanisms of TWIST1-regulated transcription in EMT and cancer metastasis. EMBO Rep. 2023;24:e56902.
- [CrossRef] [PubMed] [Google Scholar]
- Relationship of signaling pathways between RKIP expression and the inhibition of EMT-inducing transcription factors SNAIL1/2, TWIST1/2 and ZEB1/2. Cancers (Basel). 2024;16:3180.
- [CrossRef] [PubMed] [Google Scholar]
- Scavenger receptor class B member 1 promotes lung cancer growth and metastasis through enhanced twist family BHLH transcription factor 1 signaling in vitro and in vivo: Exploration of RPPNs as a therapeutic Strategy. Cytojournal. 2025;22:23. doi: 10.25259/Cytojournal_222_2024
- [CrossRef] [PubMed] [Google Scholar]
- Zeb1 mediates EMT/plasticity-associated ferroptosis sensitivity in cancer cells by regulating lipogenic enzyme expression and phospholipid composition. Nat Cell Biol. 2024;26:1470-81.
- [CrossRef] [PubMed] [Google Scholar]
- Endoplasmic reticulum stress-triggered ferroptosis via the XBP1-Hrd1-Nrf2 pathway induces EMT progression in diabetic nephropathy. Biomed Pharmacother. 2023;164:114897.
- [CrossRef] [PubMed] [Google Scholar]
- Decoding tumor microenvironment: EMT modulation in breast cancer metastasis and therapeutic resistance, and implications of novel immune checkpoint blockers. Biomed Pharmacother. 2024;181:117714.
- [CrossRef] [PubMed] [Google Scholar]
- Angiogenesis and EMT regulators in the tumor microenvironment in lung cancer and immunotherapy. Front Immunol. 2024;15:1509195.
- [CrossRef] [PubMed] [Google Scholar]
- Role of WTAP in cancer: From mechanisms to the therapeutic potential. Biomolecules. 2022;12:1224.
- [CrossRef] [PubMed] [Google Scholar]
- WTAP regulates autophagy in colon cancer cells by inhibiting FLNA through N6-methyladenosine. Cell Adh Migr. 2023;17:1-13.
- [CrossRef] [Google Scholar]