Topoisomerase II binding protein 1-interacting checkpoint and replication regulator promotes lung adenocarcinoma proliferation by regulating myelocytomatosis oncogene signaling pathway

Bioinformatic analysis

Datasets were acquired from the Cancer Genome Atlas program (TCGA) pan-cancer cohort (https://www.cancer. gov/ccg/research/genome-sequencing/tcga), particularly the TCGA-LUAD cohort database and its corresponding clinical database. The prognosis of the LUAD cohort was assessed using the Kaplan–Meier approach with the R package “survival.” The samples from the TCGA-LUAD database were categorized into two groups, namely TICRR-low and TICRR-high groups, using the median as the cutoff. Then, a comparative analysis of clinical outcomes was performed between the two groups.

To elucidate potential processes and pathways mediated by TICRR, gene set enrichment analysis (GSEA) was performed utilizing the TCGA-LUAD cohort database. The validity and reliability of TICRR levels in predicting overall survival (OS) in TCGA were assessed through an area under the receiver operating characteristic (ROC) curve analysis.

Cell culture

The human LUAD cell lines A549 (CL-0016, Procell Life Science and Technology Co., Ltd., Wuhan, China) and H1975 (CL-0298, Procell Life Science and Technology Co., Ltd., Wuhan, China) were cultured in Dulbecco’s modified eagle’s medium (11965092, ThermoFisher, Waltham, MA, USA) supplemented with 10% fetal bovine serum (A5670701, ThermoFisher, Waltham, MA, USA) and 1% penicillin/streptomycin (15140122, ThermoFisher, Waltham, MA, USA). Culturing was performed under standard conditions, involving a 5% carbon dioxide atmosphere at 37°C. The cell lines used in this study were characterized by short tandem repeat analysis and tested for mycoplasma contamination to ensure their identity and purity, reports of which can be found in the supporting documents.

Reverse transcription-quantitative polymerase chain reaction

RNA isolation from A549 and H1975 cells was conducted using a TRIzol reagent (T9108, TaKaRa, Japan). Subsequent reverse transcription was performed using the first-strand synthesis kit (18080051, ThermoFisher, Waltham, MA, USA) in accordance with the provided instructions. Quantitative polymerase chain reaction (qPCR) for complementary DNA (cDNA) quantification was conducted using the QGreenTM 2X SybrGreen qPCR Master Mix (4444556, ThermoFisher Scientific, Shanghai, China) on an ABI 7500 detection system (ABI, Los Angeles, USA). For relative expression analysis of the target genes with normalization to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), the 2^−ΔΔCt method was used. GAPDH forward primer, 5’-ACCCAGAAGACTGTGGATGG-3’; GAPDH reverse primer: 5’-TTCTAGACGGCAGGTCAGGT-3’, (Bcl-2-associated X protein) Bax forward primer, 5’-GCTGGA CATTGGACTTCCTC-3’; Bax reverse primer, 5’-ACCACT GTGACCTGCTCCA-3’; CCNB1 (Cyclin B1) forward, 5’-T CTGGATAATGGTGAATGGACA-3’; CCNB1 reverse, 5’-CGATGTGGCATACTTGTTCTTG-3’; TICRR: Forward primer, 5’GGTCCTCTGATCCTGGTCCT3’; Reverse primer, 5’GCCTGCTTTGTAGGGGTCAT3.’

Establishment of TICRR-overexpressed and TICRR-deficient LUAD cells

The wild-type group refers to A549 or H1975 cells that have not been genetically modified, serving as the control group for comparison with TICRR overexpression or knockout conditions. TICRR overexpression was achieved by initially isolating total RNA from A549 or H1975 cells, followed by reverse transcription to synthesize cDNA. Then, the full-length coding sequence of the TICRR gene was amplified by conventional polymerase chain reaction (PCR) using gene-specific primers. The resulting PCR product was verified by agarose gel electrophoresis and subsequently subcloned into the lentiviral pEIGW-FLAG overexpression vector (Innogen Pharmaceutical Technology Co., Ltd., Shanghai, China). Lentiviral particles were produced in HEK-293T cells and used to infect A549 or H1975 cells at a multiplicity of infection (MOI) of 20. After 2 days, cells were selected using 2 μg/mL puromycin (P8833, Sigma-Aldrich, St. Louis, MO, USA) for 7 days, and TICRR overexpression was confirmed by Western blot analysis.

For TICRR knockout, single guide ribonucleic acids (sgRNAs) targeting TICRR were designed using the online tool CRISPOR (http://crispor.tefor.net/), which provided an off-target risk assessment based on the predicted scores. Two sgRNAs with minimal predicted off-target effects were selected: sgRNA1# CTTCGTGGGCGACGTGATCTCGG and sgRNA2# GGGCGGCGGCACGGCCGATATGG. The synthesized sgRNA oligos (provided by Tianyi Huiyuan Biotechnology Co., Ltd., Beijing, China) were annealed by heating to 95°C followed by gradual cooling to room temperature and then cloned into lentiCRISPRv2 constructs (#98293, Addgene, Watertown, USA). The lentiCRISPRv2-sgRNA TICRR constructs, together with empty lentiCRISPRv2 vectors (used as negative controls), were packaged in HEK-293T cells. H1975 or A549 cells were infected with these viral particles at an MOI of 15 and selected using 2 μg/mL puromycin for 14 days. Knockout efficiency was quantitatively evaluated through Western blot densitometry using ImageJ software, with TICRR band intensities normalized to GAPDH.

The resulting lentiCRISPRv2-sgRNA TICRR constructs, along with empty lentiCRISPRv2 vectors, were introduced into HEK-293T cells to enrich viral representation in accordance with established procedures. Subsequently, H1975 or A549 cells were infected with virus particles containing lentiCRISPRv2-sgRNA TICRR constructs or empty lentiCRISPRv2 vectors at an MOI of 15. These cells were exposed to 2 μg/mL puromycin for 14 days. The puromycin-surviving cells were pooled for Western blot verification.

Western blots

The cell pellet was subjected to incubation with cold radio-immunoprecipitation assay buffer and vigorously vortexed for 10 min. After 15 min centrifugation, the resultant supernatant was quantified using the bicinchoninic acid assay Protein Assay Kit (23225, Thermo Scientific, Shanghai, China). Subsequently, 15 μg of the protein sample was resolved on a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel and subsequently electro-transferred onto a polyvinylidene fluoride membrane (88518, Thermo Scientific, Shanghai, China). Then, the membrane was blocked with 5% bovine serum albumin (A4628, Sigma-Aldrich, WI, USA) for 1 h at room temperature before undergoing incubation with primary antibodies, which included anti-flag (cat. no. A8592, 1:5000, Sigma-Aldrich, WI, USA), anti-GAPDH (cat. no. sc-47724; 1:5000, Santa Cruz Biotechnology, Inc., Dallas, USA), anti-Bax (cat. no. ab182733, 1:5000, Abcam, Cambridge, UK), anti-CCNB1 (cat. no. ab72, 1:5000, Abcam, Cambridge, UK), and anti-TICRR (cat. no. DPABH-21930, 1:5000, Creative Diagnostics, NY, USA) overnight at 4°C. Subsequently, the membrane underwent incubation with horseradish peroxidase-conjugated secondary antibodies (ab205718, ab205719 1:5000, Abcam, Cambridge, UK) for 1 h at room temperature. Finally, the enhanced chemiluminescence Western blotting detection system (PI32209, Fisher Scientific, Shanghai, China) was used to visualize the blots. Band intensities were quantified using ImageJ software (Bethesda, MD, USA) and normalized to GAPDH.

Cell counting kit-8 (CCK-8)

A549 and H1975 cells were seeded in a 96-well plate (260887, Thermo Scientific, Shanghai, China) at a density of 1.0 × 104 cells per well and suspended in a medium. The cells were incubated for 7 days. Subsequently, 10 μL of CCK-8 solution (C0037, Beyotime, Shanghai, China) was added to each well. After 30 min incubation, the absorbance at 450 nm was determined using a microplate reader (Kehua Technologies, Inc., Shanghai, China).

Colony formation assays

A total of 1000 A549 or H1975 cells were seeded in a 12-well plate (150628, Thermo Scientific, Shanghai, China) and incubated at 37°C. Colony formation was observed after a 2-week incubation. Colony images, each containing a minimum of 50 cells, were captured using a Nikon Eclipse Ts2 inverted microscope (Nikon Instruments Inc., Tokyo, Japan).

Luciferase reporter assays

To investigate the effect of TICRR on the MYC signaling pathway, MYC luciferase reporter vectors were co-transfected with Flag-TICRR or empty control vectors into HEK-293T cells or introduced into TICRR-deficient H1975 cells. Apart from the standard assay, negative control groups included cells transfected with empty vectors and constructs containing mutated promoters lacking the MYC-responsive element. After 48 h incubation, the relative luciferase activity was determined by calculating the ratio of firefly luciferase to Renilla luciferase activity using the Bright-Glo Luciferase Assay System (Madison, WI, USA). These negative controls ensured that the observed luciferase activity changes were specifically attributable to TICRR modulation.

Statistical analysis

The data were analyzed using GraphPad Prism 9.0 (GraphPad Software, Boston, USA), and the results were presented as means ± standard deviation. Statistical significance between the two groups was assessed using the unpaired Student’s t-test. In the case of multiple groups, one-way analysis of variance was conducted, followed by Bonferroni’s multiple comparison test. A significance level of P < 0.05 was considered statistically significant.

Aberrant expression of TICRR in patients with LUAD

The expression of TICRR was assessed across various cancers using TCGA data. A consistent upregulation of TICRR expression was observed in various cancers [Figure 1a and b]. In particular, in LUAD, the expression level of TICRR was elevated in cancerous tissues compared with normal tissues [Figure 1c and d] (P < 0.001). TICRR also showed promising diagnostic value, effectively distinguishing cancerous tissue from non-cancerous tissue, with an area under the ROC curve of 0.944 [Figure 1e]. Furthermore, the prognostic role of TICRR in lung squamous cell carcinoma (LUSC) was examined. As illustrated in Figure 1f-h, patients with low-TICRR LUSC demonstrated superior OS (P = 0.001), disease-free survival, disease-specific survival (P < 0.001), and progression-free survival (P = 0.005) compared with those with high-TICRR LUAD. These findings indicated that TICRR could serve as a prognostic indicator for poorer outcomes in LUAD. Furthermore, TICRR exhibited high expression in patients with LUAD and cancerous tissue in which high TICRR was associated with short survival of patients with LUAD.

Overexpression of TICRR aggravates the proliferation of LUAD cells

The mechanism by which TICRR affected the proliferation of LUAD cells was explored. To establish TICRR-overexpressed LUAD cell lines, lentiviral pEIGW-TICRR-FLAG-overexpressing vectors were transfected into A549 cells, and the presence of exogenous TICRR protein expression was confirmed through Western blot analysis [Figure 2a]. Subsequently, cell proliferation was assessed by examining the colony formation ability (P < 0.0001) [Figure 2b and c] and performing CCK-8 assays (P < 0.05) [Figure 2d] in TICRRoverexpressed A549 cells and control groups. The result showed that the proliferation of TICRR-overexpressed A549 cells significantly increased compared with the control groups. TICRR was also ectopically expressed in H1975 cells [Figure 2e], and enhanced proliferation was consistently observed (P < 0.0001) [Figure 2f and g]. CCk-8 was also assessed, and the result showed that TICRR promotes the proliferation of H1975 cells (P < 0.01) [Figure 2h]. Consequently, TICRR overexpression promoted the proliferation of LUAD cells.

Close

Figure 1:

Topoisomerase II binding protein 1-interacting checkpoint and replication regulator (TICRR) expression and survival analysis in patients with lung adenocarcinoma (LUAD). (a) Unpaired comparison of TICRR gene expression in the cancer genome atlas program (TCGA) pan-cancer database. (b) Paired comparison expression of the TICRR gene in the TCGA pan-cancer database. (c) Unpaired comparison of TICRR gene expression in the TCGA-LUAD database. (d) Paired comparison of TICRR gene expression in the TCGA-LUAD database. (e) The diagnostic value of TICRR in LUAD cancer by analyzing the TCGA-LUAD cohort. (f) Using the survivor package in R, the differences in prognostic indicators between low-TICRR and high-TICRR patients were assessed. Overall survival based on the TCGA-LUAD cohort. (g) Disease-specific survival based on the TCGA-LUAD cohort. (h) Progression-free survival based on the TCGALUAD cohort. (d-f) Overall survival based on the database from GSE50081, GSE157009, and GSE37745. ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001. NS: Not significant, BLCA: Bladder urothelial carcinoma, BRCA: Breast invasive carcinoma, CESC: Cervical squamous cell carcinoma and endocervical adenocarcinoma, CHOL: Cholangiocarcinoma, COAD: Colon adenocarcinoma, ESCA: Esophageal carcinoma, GBM: Glioblastoma multiforme, HNSC: Head and neck squamous cell carcinoma, KICH: Kidney chromophobe, KIRC: Kidney renal clear cell carcinoma, KIRP: Kidney renal papillary cell carcinoma, LIHC: Liver hepatocellular carcinoma, LUSC: Lung squamous cell carcinoma, PAAD: Pancreatic adenocarcinoma, PCPG: Pheochromocytoma and paraganglioma, PRAD: Prostate adenocarcinoma, READ: Rectum adenocarcinoma, STAD: Stomach adenocarcinoma, THCA: Thyroid carcinoma, UCEC: Uterine corpus endometrial carcinoma.

Export to PPT

Close

Figure 2:

Topoisomerase II binding protein 1-interacting checkpoint and replication regulator (TICRR) aggravates the proliferation of lung adenocarcinoma cells. (a) Overexpression of FLAG-TICRR in A549 was confirmed by Western blot analysis. (b and c) Colony formation assays toward A549 cells upon TICRR overexpression. (d) Figure Cell counting kit-8 (CCK-8) assay toward A549 cells upon TICRR overexpression. (e) Overexpression of FLAG-TICRR in H1975 cells was confirmed by Western blot analysis. (f and g) Colony formation assays toward H1975 cells upon TICRR overexpression. (h) CCK-8 assay toward H1975 cells upon TICRR overexpression. Data are presented as mean ± standard deviation from three independent experiments. P values are indicated (n = 3, ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001, ^✶✶✶✶P < 0.0001). GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Export to PPT

TICRR depletion ameliorates LUAD cell proliferation

After verifying the impact of TICRR overexpression on LUAD cell proliferation, the influence of TICRR depletion on LUAD cells was investigated. The CRISPR/Cas9 technique was used to knock out TICRR in A549 and H1975 cells, and the efficacy of depletion was confirmed through Western blot analysis [Figure 3a-d]. A reduction in colony formation was observed in TICRR-deficient A549 cells, as demonstrated by the quantification data (P < 0.0001) [Figure 3e] and a significant decrease in cell proliferation (P < 0.01) [Figure 3f]. In addition, the impact of TICRR depletion on H1975 cell proliferation was assessed, and a notable inhibition of cell proliferation was observed (P < 0.0001) [Figure 3g] and (P < 0.05) [Figure 3h]. Consequently, TICRR deficiency ameliorated LUAD cell proliferation.

Close

Figure 3:

Topoisomerase II binding protein 1-interacting checkpoint and replication regulator (TICRR) depletion ameliorates lung adenocarcinoma cell proliferation. (a and b) Knockout of TICRR in A549 cells using the CRISPR/Cas9 system targeting TICRR. (c and d) Knockout of TICRR in H1975 cells using the CRISPR/Cas9 system targeting TICRR. (e) Colony formation assessed by colony formation assay in A549 cells. (f) Cell counting kit-8 (CCK-8) assay toward A549 cells upon TICRR deletion. (g) Colony formation assessed by colony formation assay in H1975 cells. (h) CCK-8 assay toward H1975 cells upon TICRR deletion. Data are presented as mean ± standard deviation from three independent experiments. P values are indicated (n = 3, ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001, ^✶✶✶✶P < 0.0001). GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Export to PPT

TICRR activates the MYC signaling pathway

To further elucidate the molecular mechanism underlying the role of TICRR in LUAD progression, pathway enrichment analysis was conducted on differentially expressed genes (DEGs) derived from the TCGA-LUAD dataset. In particular, LUAD samples were stratified into high- and low-TICRR-expression groups. Differential expression analysis was performed using the DESeq2 package, with thresholds set at an adjusted P < 0.05 and an absolute log₂ fold change of >1. Then, the resultant DEGs were subjected to GSEA using the clusterProfiler package with the MSigDB Hallmark gene sets. Enrichment scores and false discovery rates (FDRs) were calculated for each pathway, and pathways with an FDR of < 0.25 were considered statistically significant. This analysis revealed that several key pathways, including E2F targets, G2M checkpoints, and MYC targets, were enriched [Figure 4].

Close

Figure 4:

Signaling pathway enrichment analysis of topoisomerase II binding protein 1-interacting checkpoint and replication regulator in lung adenocarcinoma.

Export to PPT

Given the well-established hyperactivation of the MYC signaling pathway in LUAD, we focused on the interplay between TICRR and the MYC signaling pathways. The transcriptional activity of the MYC-responsive element within the MYC luciferase reporter vector in 293T cells with varying levels of TICRR expression was also evaluated. The result showed a gradual increase in the transcriptional activity of the MYC-responsive element in 293T cells transfected with Flag-TICRR vectors (0, 50, 100, 200, 300, and 400 ng); [Figure 5a]. Conversely, TICRR-deficient H1975 cells exhibited reduced transcriptional activity of the MYC-responsive element, underscoring the positive regulatory role of TICRR in the MYC signaling pathway (P < 0.001) [Figure 5b].

Close

Figure 5:

Topoisomerase II binding protein 1-interacting checkpoint and replication regulator (TICRR) activates myelocytomatosis oncogene (MYC) signaling pathway. (a) Analysis of MYC luciferase activity in 293T cells transfected with FOXO luciferase reporter plasmid and different concentrations of TICRR-Flag vectors (0, 50, 100, 200, 300, and 400 ng). (b) Analysis of MYC luciferase activity in TICRR-deficient H1975 cells transfected with MYC luciferase reporter plasmids. (c and d) Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis of Bcl-2-associated X protein (Bax) in A549 and H1975 cells with or without EN4 treatment. (e and f) RT-qPCR of Cyclin B1 (CCNB1) in TICRR-overexpressed A549 and H1975 cells with or without EN4 treatment. (g and h) RT-qPCR analysis of Bax in TICRR-overexpressed A549 and H1975 cells. (i and j) RT-qPCR analysis of CCNB1 in TICRR-overexpressed A549 and H1975 cells. (k and l) Western blot analysis of Bax and CCNB1 in TICRR-overexpressed A549 and H1975 cells. Data are presented as mean ± standard deviation from three independent experiments. P values are indicated (n = 3, ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001, ^✶✶✶✶P < 0.0001). GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Export to PPT

Considering the pivotal roles of BAX and CCNB1 in the MYC signaling pathway, their expression in LUAD cells following TICRR modulation was assessed.^[16-19] In LUAD cells transfected with Flag-TICRR vectors, elevated levels of BAX and CCNB1 were consistently observed. However, the presence of EN4, an MYC inhibitor, effectively attenuated the increment of BAX and CCNB1 (P < 0.05) [Figure 5c-f]. TICRR deficiency in H1975 and A549 cells also led to diminished BAX and CCNB1 expression (P < 0.01) [Figure 5g-l]. Furthermore, TICRR can activate the MYC signaling pathway, thereby promoting the proliferation of LUAD cells.