Ubiquitin-specific protease 5 promotes breast cancer progression by stabilizing Forkhead box M1 through deubiquitination

Cell culture

Human breast cancer cell lines MDA-MB-231 (CL-0150), BT-20 (CL-0324), MDA-MB-453 (CL-0152), and MDAMB-468 (CL-0290) were obtained from Procell (Wuhan, China). ZR-75-30 (CRL-1504) and human embryonic kidney 293T (CRL-11268) cells were obtained from the ATCC (Manassas, VA, USA). Cell identity was verified through short tandem repeat analysis, and mycoplasma screening ensured culture purity and authenticity. Cells were cultured in Dulbecco’s modified eagle medium (DMEM) (12491015, Gibco, Grand Island, NY, USA)/Roswell Park Memorial Institute 1640 medium (RPMI-1640) (12633012, Gibco, Grand Island, NY, USA) medium containing 10% fetal bovine serum (FBS) (A5256701, Gibco, Grand Island, NY, USA) and 1% antibiotics (15140148, Gibco, Grand Island, NY, USA) at 37°C with 5% CO₂.

Cell transfection and plasmid sequences

The plasmids PHAGE-3×Flag-USP5 (FLAG-USP5) and USP5 C335A were constructed according to the methods in the “Molecular Cloning Experiment Guide.” The plasmid vector used was pcDNA3.1-Vector. Small interfering ribonucleic acid (siRNA) and short hairpin ribonucleic acid (shRNA) sequences were designed and synthesized by Shanghai Jima. The targeted sequences were as follows: siCtrl, AGUAUUGCCACGACUCGUA; siUSP5, GCCUCAAGCAGUUGGACAA; and shUSP5, CTTTGCCT TCATTAGTCACAT.

The transfection complex was prepared by mixing 2 μg of plasmid DNA, 125 μL of optimized minimum essential medium (Opti-MEM) (31985070, Gibco, Grand Island, NY, USA), and 5 μL of P3000 (L3000150, Invitrogen, Carlsbad, CA, USA). The complex was mixed with 125 μL of Opti-MEM and 5 μL of Lipofectamine 3000 (L3000150, Invitrogen, Carlsbad, CA, USA) and incubated at room temperature for 20 min. The cells were added to the mixture and cultured for 48 h for subsequent analysis. For siRNA and shRNA transfection, Lipofectamine 3000 was used according to the same procedure as described above.

For shRNA transfection, 293T cells were cultured for 48-72 h after transfection. Following collection, the viral particle-containing supernatant was used to infect target cells after filtration through a 0.45 μm filter to exclude cell debris. The medium was changed after the infection lasted for 24 h. The infected cells were cultured for 48 h and plated in 10 cm dishes at a dilution of 1:10,000 or 1:20,000. Puromycin (HYK1057, MedChemExpress, Monmouth Junction, NJ, USA) was added at the optimal concentration determined by a kill curve assay, and positive cells were selected.

Protein sample preparation and quantification

Protease and phosphatase inhibitors were added to radio immuno precipitation assay buffer (P0013B, Beyotime, Shanghai, China) lysis solution at a 1:100 ratio after cells were collected and lysed. The lysates were kept on ice for 30 min, then centrifuged at 12,000 rpm for 20 min at 4°C, and the resulting supernatant was transferred to fresh 1.5 mL microcentrifuge tubes.

The protein samples were mixed with bicinchoninic acid assay (P0012, Beyotime, Shanghai, China) in a microplate and incubated at 37°C for 30 min. Absorbance was recorded at 562 nm using Agilent BioTek Synergy Neo2 Hybrid (Agilent Technologies, Santa Clara, CA, USA).

Western blot analysis

Protein samples were prepared by adding 5× sodium dodecyl sulfate loading buffer to achieve a 1-2 μg/μL concentration, heated at 100°C for 5 min, then cooled and centrifuged. Samples were resolved on 10-12% polyacrylamide gels by electrophoresis at 60V initially, then 90V. Proteins were electroblotted onto polyvinylidene fluoride (PVDF) membranes (IPVH00010, Millipore Sigma, St. Louis, MO, USA) at 350 mA for 150 min in an ice-water bath. Membranes were washed thrice with phosphate-buffered saline with tween 20 (5 min each), then blocked with a new blocking solution for an hour at room temperature while gently agitating, followed by another three washes with PBST. The application of primary antibodies occurred overnight at 4°C: Anti-tubulin (1:1000, ab52866, Abcam), anti-USP5 (1:1000, ab154170, Abcam), and anti-FOXM1 (1:1000, ab207298, Abcam). After three rounds of PBST washing, blots were probed for 60 min at ambient temperature with species-matched horseradish peroxidase-linked secondary immunoreagent (goat α-rabbit IgG, 1:5000 dilution; Cell Signaling Technology #7074) suspended in 5% non-fat dairy blocking buffer. Protein bands were visualized using enhanced chemiluminescence reagent (BL520A, BioSharp, Hefei, China) on the ChemiDoc XRS+ system (Bio-Rad, Hercules, CA, USA) and quantified with ImageJ software (version 1.5f, NIH, Maryland, USA). Expression levels were normalized to the tubulin loading control.

Co-IP and endogenous ubiquitination assay

A Co-IP assay was performed by capturing target proteins and their interacting partners using specific antibodies. After cell lysis, the target protein antibody was incubated with protein A/G magnetic beads (88803, Thermo Fisher Scientific, Waltham, MA, USA) and then washed. Interacting proteins were detected by Western blot analysis.

Cells were cultured in six-well plates and transfected with a short hairpin RNA (shRNA) plasmid targeting USP5 (shUSP5) or a non-targeting negative control shRNA plasmid (shNC) plasmids (BT-20) or Flag-USP5 and Flag-vector plasmids (MDA-MB-231) using a standard transfection reagent up to approximately 70% confluence. After a duration of 48 h, the cells received a treatment of 10 μM MG132 (S2619, Selleck Chemicals, Houston, TX, USA) for 12 h to stabilize protein levels. Total cellular proteins were extracted, and 5 μL of FOXM1 antibody was added to the cell lysate. Overnight incubation of the mixture was performed at 4°C on a rotary shaker. Immunoprecipitation was performed using the FOXM1 antibody. Samples were analyzed as input (total lysate) and immunoprecipitated (IP) fractions, comparing control groups (Flag-vector for MDA-MB-231 cells; shNC for BT-20 cells) with experimental groups (Flag-USP5 for MDA-MB-231 cells; shUSP5 for BT-20 cells). The ubiquitination levels of IP: FOXM1 proteins were detected using Ub antibody, while the protein expression levels of USP5, FOXM1, and tubulin were analyzed in input groups using a Bio-Rad chemiluminescence imaging system.

Quantitative real-time polymerase chain reaction (qRT-PCR)

After washing cells with PBS, total RNA was extracted using TRIzol (15596026CN, Thermo Fisher Scientific, Waltham, MA, USA) and chloroform. The aqueous phase was combined with half its volume of isopropanol, incubated for 10 min at room temperature, then centrifuged at 12,000 g for 15 min at 4°C. RNA pellets were washed, air-dried, resuspended in RNase-free water, and quantified using NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). One microgram of RNA was reverse-transcribed to complementary DNA (cDNA) using RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Fisher Scientific, Waltham, MA, USA). qRT-PCR analysis utilized PowerUp SYBR Green Master Mix (A57155, Thermo Fisher Scientific, Waltham, MA, USA) on QuantStudio 5 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) with triplicate reactions. Initial denaturation at 95°C for 2 min was part of the thermal cycling parameters, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The 2^−ΔΔCt was employed to determine relative expression levels, using GAPDH as the reference gene. The primers used were as follows: USP5 Forward primer: GAAGTGTTCCGCTTCTTGGTGG; Reverse primer: TTGC CGCTTCTTCTCCTCGTAC. FOXM1: Forward primer: TCTGCCAATGGCAAGGTCTCCT; Reverse primer: CTGG ATTCGGTCGTTTCTGCTG. GAPDH: Forward primer: GTCTCCTCTGACTTCAACAGCG; Reverse primer: ACC ACCCTGTTGCTGTAGCCAA.

Cell counting kit-8 (CCK-8) assay

Each well of a 96-well plate received 100 μL of the cell suspension after the cells were digested and resuspended to 3×10⁴ cells/mL at 24 h after transfection. The cells were examined under a microscope (Olympus IX73, Olympus Corporation, Tokyo, Japan) to verify satisfactory adherence after a 24 h incubation period. After the medium was withdrawn, the cells were added with 100 μL of new media containing 10% CCK-8 solution (C0038, Beyotime, Shanghai, China). The cells were incubated for 2 h, and absorbance was recorded at 450 nm using Agilent BioTek Synergy Neo2 Hybrid. The same procedure was repeated at 48 and 72 h, and OD values were plotted.

Wound healing assay

After the cells were digested, counted, and reconstituted to 2×10⁵ cells/mL, log-phase cells were planted onto six-well plates. When the cells reached 90% confluence, the medium was removed, and the cell monolayer was scratched using a sterile pipette tip. The monolayer was cleaned with PBS and incubated with a new medium. At 0, 24, and 48 h, pictures were captured under a microscope (Olympus IX73, Olympus Corporation, Tokyo, Japan). The following formula was used to determine wound healing: healing rate (%) = (0 h area - time-point area)/0 h area. ImageJ software (version 1.5f, NIH, Maryland, USA) was used to measure the scratch area.

Transwell migration assay

Forty-eight hours post-transfection, cells were resuspended to 1×10⁵ cells/mL in serum-free medium. The lower compartment of the Transwell chambers was filled with 800 μL of DMEM/RPMI-1640 with 20% FBS, while the upper compartment contained 200 μL of cell suspension. After incubating for 48 h, the inserts were rinsed with PBS, fixed in 4% paraformaldehyde for half an hour, and then stained with 0.1% crystal violet for 10 min. Following washing and drying, cells that had migrated were counted in three random fields at 200× magnification with an inverted microscope (Olympus IX73, Olympus Corporation, Tokyo, Japan), and the mean count was determined.

Construction of a subcutaneous xenograft mouse model of breast cancer

Twenty 5-week-old nude mice were acclimated for 1 week at 20-26°C with 40-70% humidity under 12 h light/dark cycles, with ad libitum access to food and water. After confirming optimal cell viability, cells were harvested and counted. The mice were put under anesthesia using an intraperitoneal injection of 2% pentobarbital sodium at a dose of 50 mg/kg. A single-cell suspension with a concentration of 1×10⁹ cells/mL was made. About 200 μL of this suspension, which contains 5×10⁶ cells, was administered into the right axilla of each mouse, and 20 mice were organized into four groups. After 1 day, the mice were observed for changes in their general condition, and the injection site was checked for any abnormalities. Throughout the study, the mice received fresh food every 3 days, and their bedding and water were replaced. Body weight and tumor size were recorded every 2 days, and tumor growth was observed over a 2-week period. The mice were then placed in a carbon dioxide anesthesia box. After losing consciousness, the carbon dioxide concentration was increased to 100% and maintained for an additional 2 min to ensure death.

Bioinformatics

Data on FOXM1 expression in both breast cancer and normal tissues were retrieved from TCGA through the gene expression profiling interactive analysis 2^nd (GEPIA2) platform (http://gepia2.cancer-pku.cn) and analyzed for differential expression. GEPIA2 was also used to analyze the relationship between USP5 and FOXM1 expression. The TCGA and GTEx data were used to explore gene expression profiles and relationships in various cancers, including breast cancer. Immunohistochemistry data were retrieved from the Human Protein Atlas (HPA) database (https://www.proteinatlas.org) to assess FOXM1 protein levels in breast cancer tissues. Survival of FOXM1 expression and overall patient survival were analyzed using the Kaplan-Meier Plotter online analysis tool (http://kmplot.com/analysis). Potential DUBs interacting with FOXM1 were predicted using the UbiBrowser database (http://ubibrowser.ncpsb. org), which integrates experimental evidence and machine learning-based predictions.

Statistical analysis

The creation of graphs and the performance of statistical analyses were done using GraphPad Prism 9.5.0 (Version 9.5.0; La Jolla, CA, USA). The data are shown as the mean ± standard deviation. Each experiment was conducted a minimum of 3 times independently. Unpaired Student’s t-tests compared two groups; multi-group analyses used one-way analysis of variance with Tukey’s post hoc testing. Statistical significance is marked by asterisks: ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001.

Interaction between USP5 and FOXM1 in breast cancer

Prior investigations demonstrated a notable association between increased FOXM1 expression in breast cancer tissues and poor patient prognosis.^[19] In the present research, we conducted a systematic analysis of the TCGA public database to investigate FOXM1 expression patterns in patients with breast cancer. Compared to normal breast tissues, FOXM1 levels were quadrupled in breast cancer tissues. Hence, FOXM1 might be significant in the emergence and onset of breast cancer [Figure 1a]. Differences in FOXM1 protein levels were validated by immunohistochemical analysis of FOXM1 expression in breast cancer tissues obtained from the HPA database [Figure 1b].

Close

Figure 1:

Interaction between ubiquitin-specific protease 5 (USP5) and Forkhead box M1 (FOXM1) in breast cancer. (a) FOXM1 expression was validated using the GEPIA2 platform, with red boxes indicating cancer tissues and blue boxes indicating normal tissues in The Cancer Genome Atlas datasets. (b) The Human Protein Atlas database includes immunohistochemical staining information for FOXM1. (c) Messenger ribonucleic acid expression level of FOXM1 in these cells was determined by quantitative reverse transcription polymerase chain reaction. (d and e) Protein expression of FOXM1 was analyzed by Western blot and quantified. (f) The Kaplan-Meier plotter database provides survival curves for comparing FOXM1 expression levels in breast cancer. (g and h) HeLa cells were treated with DMSO or 100, 200, and 500 nM PR-619 for 24 h, and differences in FOXM1 expression were analyzed by Western blot and quantification analysis. (i) The UbiBrowser website was used to identify deubiquitinating enzymes upstream of FOXM1. (j and k) In MDA-MB-231 cells, proteins were collected after treatment with 10 μM MG132 for 10 h. An interaction between endogenous FOXM1 and USP5 was shown by Co-IP experiments. (l and m) In BT-20 cells, following a 10 h treatment with 10 μM MG132, endogenous FOXM1 was co-IP with USP5. ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001. GEPIA: Gene Expression Profiling Interactive Analysis, OS: Overall survival, RFS: Relapse-free survival, DMSO: Dimethyl sulfoxide.

Export to PPT

FOXM1 expression levels were evaluated across multiple breast cancer cell lines (MDA-MB-231, BT-20, MDA-MB-453, ZR-75-30, MDA-MB-468) and normal MCF-10A cells through qRT-PCR and Western blotting. Cancer cell lines demonstrated markedly increased FOXM1 levels [Figures 1c-e]. Kaplan-Meier analysis revealed that elevated FOXM1 expression correlated with reduced overall survival in breast cancer patients (Figure 1f), indicating its potential as a prognostic indicator. However, regulatory factors upstream of FOXM1 in breast cancer remain underexplored. Therefore, to investigate the molecular mechanisms underlying FOXM1 dysregulation during cancer progression, we examined whether DUB activity influences the amount of FOXM1.

To assess the effect of DUB activity on FOXM1 levels, HeLa cells were exposed to the non-specific small-molecule DUB inhibitor PR-619 for a duration of 24 h. The Western blot analysis revealed a significant decrease in FOXM1 protein levels as the concentration of PR-619 increased [Figure 1g and h]. This finding suggests that DUBs actively prevent FOXM1 degradation. We then used UbiBrowser (http://ubibrowser.ncpsb.org), a tool designed to explore the interaction network of Ub ligase substrates, to identify five known DUBs [Figure 1i]. Notably, USP5, similar to FOXM1, is a known oncogene, but its role in breast cancer remains underinvestigated.

We then explored the role of USP5 in regulating FOXM1. We investigated whether USP5 interacts with FOXM1 to promote its oncogenic function in breast cancer cells. Endogenous interactions between USP5 and FOXM1 were confirmed in MDA-MB-231 and BT-20 cells [Figures 1j-m]. In summary, USP5 interacts with FOXM1, suggesting the critical role of USP5 in regulating FOXM1 in breast cancer.

USP5 modulates FOXM1 protein expression and increases FOXM1 protein stability

We next investigated whether USP5 could regulate the expression of FOXM1. Initially, we tried to investigate the connection between USP5 and FOXM1 at the transcriptional level through qRT-PCR analysis. The overexpression of USP5 in MDA-MB-231 cells [Figure 2a] or the knockdown of USP5 in BT-20 cells [Figure 2b] had no effect on the messenger ribonucleic acid levels of FOXM1. The Western blot revealed that the overexpression of USP5 in MDA-MB-231 cells significantly increased FOXM1 protein levels [Figure 2c and d], while the knockdown of USP5 in BT-20 cells decreased FOXM1 protein expression [Figure 2e and f]. To further explore whether the protein expression of FOXM1 increases with increasing USP5 expression, we transfected MDA-MB-231 cells with 1, 2, or 3 μg of USP5 overexpression plasmids. After 48 h, we assessed the protein levels of USP5 and FOXM1 by Western blot analysis. As the expression level of the USP5 protein increased, the FOXM1 protein levels also increased correspondingly [Figure 2g-h]. These experimental results suggest that USP5 regulates FOXM1 expression at the post-transcriptional level, rather than affecting its transcription.

Close

Figure 2:

Ubiquitin-specific protease 5 (USP5) modulates Forkhead box M1 (FOXM1) protein expression and increases FOXM1 protein stability. (a) FOXM1 messenger ribonucleic acid (mRNA) expression in USP5 overexpression and vector groups in MDA-MB-231 cells. (b) quantitative reverse transcription polymerase chain reaction analysis of FOXM1 mRNA expression in USP5 knockdown and negative control groups in BT-20 cells. (c and d) FOXM1 protein expression in MDA-MB-231 cells was assessed in the vector group and the USP5 overexpression group. (e and f) Evaluation of FOXM1 protein expression in BT-20 cells included the USP5 knockdown and negative control groups. (g and h) In MDA-MB-231 cells, increasing amounts of USP5 overexpression plasmid (0, 1, 2, and 3 μg) were transfected, and FOXM1 protein expression was analyzed by Western blot. (i and j) MDA-MB-231 cells were treated with cycloheximide (CHX) (200 μg/mL) at various intervals, and USP5 and FOXM1 protein levels were compared between the USP5 overexpression group and the vector group. (k and l) Following varying durations of CHX (200 μg/mL) treatment of BT-20 cells, the protein expression levels of FOXM1 and USP5 were analyzed in the negative control group and the USP5 knockdown group. ns = Not significant, ^✶✶P < 0.01, ^✶✶✶P < 0.001.

Export to PPT

To further explore whether USP5 influences FOXM1 protein levels by regulating its degradation, we used cycloheximide (CHX), an inhibitor of eukaryotic protein synthesis, to prevent protein production in cells. We then measured FOXM1 expression at various time points using Western blot analysis. The CHX stability assays revealed that in MDA-MB-231 cells overexpressing USP5, the half-life of the FOXM1 protein was significantly longer than that in the negative control group when treated with CHX for different durations [Figure 2i and j]. Similarly, in BT-20 cells with USP5 knockdown, the FOXM1 protein exhibited shorter half-life than the negative control group under CHX treatment for varying time periods [Figure 2k and l]. These findings confirm that USP5 enhances the stability of the FOXM1 protein by modulating its degradation.

USP5 stabilizes FOXM1 function by promoting its deubiquitination

In previous experiments, we observed that USP5 enhances the stability of the FOXM1 protein and inhibits its degradation. In eukaryotic cells, the primary protein degradation pathways are the lysosomal pathway and the Ub-proteasome pathway. Considering that USP5 is a deubiquitinase, we hypothesize that it may inhibit the Ub-proteasome-mediated degradation of FOXM1. We treated Flag-USP5-transfected MDA-MB-231 cells or siRNA-USP5-transfected BT-20 cells with the proteasome inhibitor MG132 to determine if USP5 affects FOXM1 through the proteasomal degradation pathway. The increased expression of FOXM1 induced by USP5 overexpression was further enhanced after MG132 treatment [Figure 3a and b]. Similarly, the decrease in FOXM1 expression caused by USP5 knockdown could be partially rescued by inhibiting its proteasomal degradation [Figure 3c and d].

Close

Figure 3:

Ubiquitin-specific protease 5 (USP5) stabilizes Forkhead box M1 (FOXM1) function by promoting its deubiquitination. (a and b) Protein expression of FOXM1 in Flag-USP5-transfected MDA-MB-231 cells treated with MG132 (20 μM) for 10 h was assessed by Western blot. (c and d) Protein expression of FOXM1 was assessed by Western blot in MDA-MB-231 cells treated with MG132 (20 μM) for 10 h and transfected with small interfering ribonucleic acid targeting USP5. (e) The schematic diagram shows wild-type (WT) USP5 and its enzymatic activity mutant (C335A). (f and g) Increasing amounts of Flag-USP5^C335A (0, 1, 2, and 3 μg) were transfected into MDA-MB-231 cells, and FOXM1 protein expression was analyzed by Western blot. (h-j) MDA-MB-231 cells were transfected with Flag-USP5 (WT/C335A) plasmids, and FOXM1 protein expression was analyzed by Western blot. (k) Immunoprecipitation using a FOXM1 antibody, followed by Western blot analysis with an Ub antibody, was performed to assess the ubiquitination of endogenous FOXM1 in MDA-MB-231 cells overexpressing USP5. (l) Immunoprecipitation using a FOXM1 antibody, followed by Western blot analysis with an Ub antibody, was conducted to evaluate the ubiquitination of endogenous FOXM1 in BT-20 cells with USP5 knockdown. ns = Not significant, ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001.

Export to PPT

USP5, as a deubiquitinase, primarily enhances the stability of target proteins by inhibiting the Ub-proteasome-dependent degradation pathway. Therefore, in subsequent experiments, we focused on investigating whether USP5 deubiquitinates FOXM1 and affects its protein stability. As shown in Figure 3e, we transfected cells with a plasmid encoding the catalytically inactive mutant (C335A) to assess the deubiquitination activity of the USP5 mutant. The USP5 C335A mutant failed to increase the expression of exogenous FOXM1 in a dose-dependent manner, indicating that the deubiquitinase activity of USP5 is essential to promote FOXM1 stability [Figure 3f and g]. Overexpression of the USP5 plasmid, but not the USP5 mutant plasmid, increased the endogenous FOXM1 protein expression in MDA-MB-231 cells [Figure 3h-j].

To confirm whether USP5 acts as an upstream deubiquitinase of FOXM1 and affects the ubiquitination levels of FOXM1 in breast cancer cells, we performed an endogenous ubiquitination assay. In USP5-overexpressing MDA-MB-231 cells, the Ub conjugates on FOXM1 were significantly reduced compared with the negative control [Figure 3k]. In USP5-silenced BT-20 cells, the ubiquitination of FOXM1 was increased [Figure 3l]. These findings suggest that USP5 promotes FOXM1 stability by deubiquitinating it.

USP5 significantly promotes the malignant progression of breast cancer cells

We further explored how USP5 contributes to the malignant characteristics of breast cancer. CCK-8 assays revealed that cells with increased USP5 expression showed significantly higher proliferation compared to the control group [Figure 4a]. Meanwhile, USP5 knockdown inhibited cell proliferation [Figure 4b]. To assess the potential role of USP5 in the spread of breast cancer, we performed scratch and Transwell migration assays. The MDA-MB-231 cells overexpressing USP5 exhibited significantly enhanced wound healing capacity in the scratch assay compared with the control cells [Figure 4c and d], while USP5 knockdown in BT-20 cells led to reduced healing ability [Figure 4e and f]. The Transwell migration assay demonstrated that USP5 overexpression enhanced the migratory capacity of MDAMB-231 cells [Figure 4g and h], whereas knocking down USP5 significantly reduced the migration of BT-20 cells [Figure 4i and j]. Hence, USP5 could be crucial in supporting the malignant progression of breast cancer.

Close

Figure 4:

Ubiquitin-specific protease 5 (USP5) significantly promotes the malignant progression of breast cancer cells. (a) Cell counting kit 8 (CCK-8) assay was used to detect the cell proliferation of MDA-MB-231 cells in the USP5 overexpression group and the vector group. (b) CCK-8 assay was employed to measure cell proliferation in BT-20 cells for both USP5 knockdown group and negative control group. (c and d) Images from the scratch assay in MDA-MB-231 cells comparing the USP5 overexpression group with the vector group (Scale bar: 100 μm). (e and f) Images from the scratch assay in BT-20 cells showing a comparison between the USP5 knockdown group and the negative control group (Scale bar: 100 μm). (g and h) Representative images of the Transwell migration assay in MDA-MB-231 cells comparing the USP5 overexpression group and the vector group (Scale bar: 100 μm). (i and j) Representative images of the Transwell migration assay in BT-20 cells comparing the USP5 knockdown group and the negative control group (200×, Scale bar: 100 μm). ^✶✶✶P < 0.001.

Export to PPT

USP5 promotes malignant progression of breast cancer by regulating FOXM1 stability

Our study demonstrates that USP5 significantly enhances the proliferation, migration, and invasion of breast cancer cells. Further analysis revealed that USP5 deubiquitinates FOXM1, thereby stabilizing its protein levels. We employed MDAMB-231 cells in a functional rescue experiment, splitting them into four treatment groups, to examine the function of USP5 in breast cancer (negative control group, USP5 overexpression group, FOXM1 knockdown group, and USP5 overexpression with simultaneous FOXM1 knockdown group). The expression levels of USP5 and FOXM1 in each group were confirmed through Western blot analysis [Figure 5a-c]. We then performed CCK-8 cell proliferation, scratch, and Transwell invasion assays on the four groups. The proliferative influence of USP5 overexpression in MDA-MB-231 cells was partially mitigated by FOXM1 knockdown, as indicated by the CCK-8 assay [Figure 5d]. In scratch and Transwell invasion assays, FOXM1 knockdown largely reversed the effect of USP5 overexpression on enhancing MDA-MB-231 cell migration and invasion [Figure 5e-h]. These functional rescue experiments confirm that USP5 promotes the malignant progression of breast cancer through FOXM1.

Close

Figure 5:

Ubiquitin-specific protease 5 (USP5) promotes malignant progression of breast cancer by regulating Forkhead box M1 (FOXM1) stability. (a-c) Expressions of USP5 and FOXM1 were detected by Western blot assay. (d) Cell counting kit 8 (CCK-8) assay detected that USP5 promoted MDA-MB-231 cell proliferation through FOXM1. (e and f) Images showing Transwell migration assays of MDA-MB-231 cells with Flag-USP5 plasmid and short hairpin ribonucleic acid (shRNA)-FOXM1, or Flag-USP5 plasmid, or shRNA-FOXM1 (200×, Scale bar: 100 µm).. (g and h) Images representing the scratch assay of MDA-MB-231 cells with Flag-USP5 plasmid and shRNA-FOXM1, or Flag-USP5 plasmid, or shRNA-FOXM1 (200×, Scale bar: 100 µm).. (i) MDA-MB-231 cell xenograft tumor endpoint image. (j) Statistical plots of tumor weight at the end point of each group. (k and l) Immunohistochemical staining of Ki-67 in tumor tissues from different groups showing changes in proliferation levels (200×, Scale bar: 100 µm).. (m) Correlation between USP5 and FOXM1 from GEPIA2. (200×, Scale bar: 100 μm). ^✶P < 0.05, ^✶✶P < 0.01, ^✶✶✶P < 0.001. GEPIA: Gene Expression Profiling Interactive Analysis

Export to PPT

MDA-MB-231 cells from different treatment groups were implanted into nude mice to investigate the USP5-FOXM1 axis in breast cancer treatment. The tumor volume [Figure 5i] and weight [Figure 5j] significantly decreased in the FOXM1 knockdown group. Compared with those in the USP5 overexpression group, tumors with USP5 overexpression accompanied by FOXM1 knockdown were smaller, reversing the pro-tumor effects of USP5 overexpression [Figure 5i and j]. Immunohistochemical analysis of the cell proliferation marker Ki-67 revealed increased staining in the USP5 overexpression group and reduced staining in the FOXM1 knockdown group. USP5 overexpression with the FOXM1 knockdown group showed reduced staining relative to the USP5 overexpression group alone [Figure 5k and l], further supporting the role of USP5 in promoting tumor growth through FOXM1. Hence, USP5 overexpression promotes the proliferation of MDA-MB-231 cells, and FOXM1 knockdown partially reverses this proliferative effect. Additional examination of the TCGA databases showed a notable link between USP5 and FOXM1 expression in breast cancer patients, reinforcing the possibility of a close interaction between these genes [Figure 5m].

Together with the results from our experiments and database analysis, our study uncovers the potential role and underlying mechanism of the USP5-FOXM1 axis in breast cancer. USP5 stabilizes FOXM1 protein levels through deubiquitination, thereby promoting the malignant progression of breast cancer.