Translate this page into:
Zinc finger TRAF-type containing 1 can promote the progression and metastasis of lung adenocarcinoma
*Corresponding author: Liang Song, Department of Thoracic Surgery, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, China. songliang1120@hotmail.com
-
Received: ,
Accepted: ,
How to cite this article: Yu Y, Zhao Q, Song L. Zinc finger TRAF-type containing 1 can promote the progression and metastasis of lung adenocarcinoma. CytoJournal. 2026;23:12. doi: 10.25259/Cytojournal_49_2025
Abstract
Objective:
Lung adenocarcinoma is a type of lung cancer that falls under the category of non-small cell carcinoma. Given its high incidence, it has attracted considerable attention. Zinc finger TRAF-type containing 1 (ZFTRAF1) was found in a two-hybrid yeast screening with muine galectin-3. However, the link between ZFTRAF1 and lung adenocarcinoma was unclear. This study aimed to explore the influencing mechanism of ZFTRAF1 on lung adenocarcinoma.
Material and Methods:
In this study, by silencing or overexpressing ZFTRAF1, we investigated the migration and invasion ability of A549 and HCC827 cells. In addition, the polarization effect of ZFTRAF1 on macrophages was evaluated through flow cytometry and quantitative real-time polymerase chain reaction. Finally, tumor growth and development were evaluated through histological analysis in vivo and Western Blot analysis in vitro.
Results:
ZFTRAF1 was down-regulated in normal lung cells. Silencing of ZFTRAF1 inhibited migration, invasion of A549 and HCC827 cells, and the formation of tumors. Reduction of the expression of ZFTRAF1 inhibited the epithelial–mesenchymal transition, suppressed the phosphoinositide 3-kinase–protein kinase B pathway, and enhanced the polarization of M1 macrophages. In addition, the overexpression of ZFTRAF1 showed an opposite trend compared with its silencing in A549 and HCC827 cells.
Conclusion:
ZFTRAF1 promotes lung cancer development. Regulating the expression level of ZFTRAF1 to interfere with the growth and migration of lung adenocarcinoma may be a new strategy for the treatment of lung adenocarcinoma. In addition, the theoretical foundation for ZFTRAF1’s therapeutic use is provided in this work.
Keywords
Epithelial–mesenchymal transition
Lung adenocarcinoma
Phosphoinositide 3-kinase
Protein kinase B
Zinc finger TRAF-type containing 1
INTRODUCTION
Lung cancer refers to a common primary lung cancer prevalent in the world, with an incidence increasing annually.[1] Lung adenocarcinoma is a form of lung cancer that falls under the category of non-small cell carcinoma.[2] The treatment success rate of lung adenocarcinoma patients is not high, and recurrence and metastasis are possible.[3] Therefore, finding the therapeutic target of lung adenocarcinoma and investigating the possible mechanism are the hot spots and challenges of the current research.
Zinc finger TRAF-type containing 1 (ZFTRAF1) was identified as a binding partner of galectin-3 during 2-hybrid yeast screening.[4] Under specific physiological conditions that identify novel cytoplasmic proteins involved in intracellular transport, ZFTRAF1 forms complexes with lectins that bind laminin.[5] However, reports regarding ZFTRAF1 are limited, and only biallelic loss-of-function variants of ZFTRAF1 have been found to cause neurodevelopmental disorders.[6] Moreover, ZFTRAF1 may be used as a biomarker to predict the development of precancerous lesions and identify esophageal squamous cell carcinoma early.[7] The role of ZFTRAF1 in other diseases has not been reported.
The phosphoinositide 3-kinase (PI3K)I3K)nase (PI3K) es hAKT) signaling pathway is a widely preserved and important communication network found in all complex organisms, and it facilitates the survival, growth, and multiplication of cells.[8,9] In this pathway, PI3K and protein kinase B (AKT) serve as the major functional proteins.[10,11] The association between the PI3K-AKT signaling and lung carcinoma invasion has been reported.[12,13] Furthermore, the PI3K-AKT pathway’s transitional activity plays a crucial role in promoting epithelial-mesenchymal transformation (EMT) and metastasis, considerably influencing cell migration.[14] Consequently, researchers have shown significant interest in medicines that target PI3K-AKT signaling.
Based on the above-mentioned research report gaps, this study aimed to explore the possible influencing mechanism of ZFTRAF1 in lung adenocarcinoma. We discussed the role of ZFTRAF1 in lung adenocarcinoma through the changes in key indicators of lung adenocarcinoma cells, EMT, and xenograft tumors. In addition, we analyzed potential downstream molecular events to provide a theoretical basis for therapeutic strategies in patients with lung adenocarcinoma.
MATERIAL AND METHODS
Cell culture
BEAS-2B (BFN6080086), THP-1 (BFN60700157), A549 (BFN60800665), and HCC827 (BFN60800668) cell lines were mycoplasma-free and derived from parental cells according to short tandem repeat analysis. All cells were obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were grown in Dulbecco’s Modified Eagle Medium (DMEM, D2429, Sigma, St. Louis, MO, USA). THP-1 cells were cultured in high-glucose DMEM (PM150210B, Pricella Biotechnology, Wuhan, China) supplemented with 10% fetal bovine serum (BL201A, Biosharp, Hubei, China). Culture conditions were 37℃ and 5% CO2.
Cell transfection
Lentivirus-transfected cells were used in this study. ZFTRAF1-interfering lentiviruses (sh-ZFTRAF1), negative control (NC) lentiviruses, ZFTRAF1-overexpressing lentiviruses (OE-ZFTRAF1), and corresponding NC (OE-NC) were all from GenePharma Co., Ltd (Shanghai, China). A total of 1 × 105 cells were inoculated in 24-well plates of 500 µL medium and cultured overnight at 37°C with 5% CO2. When the cell density changed to 40–50%, 10 µg/mL polybrene (H8761, Solarbio, Beijing, China) was added for lentiviral transfection, and fresh medium was replaced 24 h later. The transfection efficiency was observed through fluorescence microscopy (Olympus, Tokyo, Japan). After transfection for 74 h, the cells were incubated again for 24 h with fresh medium containing 4 µg/mL purinomycin. ZFTRAF1 shRNA: 5’-GGAGGAGCAGGCCACGUGCUU-3’.
Cell viability assay
Cell viability was measured using a Cell Counting Kit-8 (CCK-8) kit (CA1210, Solarbio, Beijing, China). A total of 3,000 cells were added to 96-well plates, and 100 µL complete medium was added. The cells were incubated at a temperature of 37°C. Then, 10 µL CCK8 reagent was added, and the culture was continued for 2 h. Finally, the absorbance was observed at 450 nm using an enzyme-labeled instrument (A96, Mettler Toledo, Zurich, Switzerland).
Trypan blue exclusion assay
After 5 days of transfection, the cells were processed into a single-cell suspension and combined with 0.4% Trypan Blue reagent at a 9:1 ratio (C0040, Solarbio, Beijing, China). After 3–5 min, the cells were examined using a microscope (BX51FL, Olympus, Tokyo, Japan).
Transwell assay
The Transwell assay was conducted in a cell culture chamber with an aperture of 8 µm. A total of 2 × 104 cells were added to the upper chamber, and 600 µL culture medium was added to the lower chamber. After 24 h, a cotton swab was used to remove leftover cells from the top. The filters were then fixed with 4% paraformaldehyde for 20 min at 25°C and stained with 0.1% crystal violet solution (BL802A, Biosharp, Hubei, China) for 30 min at room temperature. Three clear visual images were randomly selected through a microscope (×200, CX41-32RFL, Olympus Corporation, Tokyo, Japan) for photo statistics. In the invasion experiment, the filter was topped with 60 µL Matrigel. The rest of the experimental process is the same as that for Transwell migration.
Wound-healing assay
Exactly 5 × 104 cells were inoculated into a six-well plate and cultured for 24 h. To remove isolated cells, we scraped the tip of a pipette head and washed it with phosphate buffer saline (BL2214A, Biosharp, Hubei, China). The 48 h cell images were observed with an inverted microscope (CX41-32RFL, Olympus Corporation, Tokyo, Japan).
Macrophages were co-cultured with lung adenocarcinoma cells
A549 or HCC827 cells and THP-1 macrophages were co-cultured in a Transwell chamber. The chamber was a six-well plate with a diameter of 0.4 µm. THP-1 cells were inoculated at a density of 5 × 105 cells/well, and phorbol 12-myristate 13-acetate (HY-18739, MedChemExpress, Monmouth County, NJ, USA) was added to differentiate THP-1 cells into macrophages.[15]
Flow cytometry
The collected cells were stained with anti-CD86-APC (APC-65068), anti-CD163-FITC (FITC-65522), and anti-CD64-Atlantic Blue (AB-65253). The antibody was purchased from Proteintech (Wuhan, China). Flow cytometry (FACS Aria III, BD, USA) was performed for detection, and FlowJo V1.8 software (BD Bioscience, Franklinhoo, New Jersey, USA) was used for statistical analysis.
Animals
A total of 80 male Balb/c nude mice (4–6 weeks) were housed in individual ventilated cages. The feeding conditions were as follows: specific pathogen free (SPF) grade, 23 ± 1°C temperature, and 12 h light and dark cycle. The mice were randomly divided into four groups: control (A549 and HCC827 cells) and KD (A549 and HCC827 cells with down-regulated ZFTRAF1 expression). Each group of mice received injections of 2 × 106 cells in the right axillary region. The tumor growth of mice was observed regularly, and the long (a) and short diameters (b) of the tumor were measured. The mice were killed via cervical dislocation 4 weeks later. The tumors were gathered, weighed, and captured on camera. The tumor volume was calculated using the expression ab2/2. The collected tumors were fixed in 4% paraformaldehyde solution (P1110, Solarbio, Beijing, China) or frozen in a −80°C refrigerator.
Quantitative real-time polymerase chain reaction (QRT-PCR)
Cells were subjected to RNA extraction using TRIzol reagent (R0016, Beyotime Biotechnology, Shanghai, China). Reverse transcription was carried out using PrimeScript™rRT reagent Kit (RR037A). TB Green® Premix Ex Taq™ II FAST qPCR(CN830A) was used to perform qRT-PCR. The kits and qPCR reagents were purchased from TAKARA (Kafu City, Yamanashi Prefecture, Japan). The relative expression was calculated using 2−ΔΔCt. GAPDH was used as an internal reference. Table 1 shows the primer sequences.
| Primers | Primes sequences (5’-3’) |
|---|---|
| ZFTRAF1 | |
| Forward | CAGGACAGGGTAACCCAGTG |
| Reversed | CGGAACTGGACCTCTGTGTAG |
| IL-1α | |
| Forward | TGAGTTTTGGTGTTTCTGGC |
| Reversed | TCGGGAGACGACTCTAA |
| IL-1β | |
| Forward | TGAACTGAAAGCTCTCCACCT |
| Reversed | ACTGGGCAGACTCAAATTCCA |
| IL-6 | |
| Forward | TGCCTTCTTGGGACTGATG |
| Reversed | ACTCTGGCTTTGTCTTTCTTGT |
| TNF-α | |
| Forward | CATCTTCTCAAAATTCGAGTGACAA |
| Reversed | TGGGAGTAGACACAAGGTACAACCC |
| Arg-1 | |
| Forward | CAGAAGAATGGAAGAGTCAG |
| Reversed | CAGATATGCAGGGAGTCACC |
| IL-10 | |
| Forward | TGGCCTTGTAGACACCTTGG |
| Reversed | AGCTGAAGACCCTCAGGATG |
| IL-13 | |
| Forward | TGATAGAAAACCTGAAGAAAGCC |
| Reversed | AGATAACAAATGGAGAATGGGAA |
| TGF-β | |
| Forward | TGAACCGGCCTTTCCTGCTTCTCATG |
| Reversed | GCGGAAGTCAATGTACAGCTGCCGC |
| GAPDH | |
| Forward | AATCCCATCACCATCTTCCA |
| Reversed | CCTGCTTCACCACCTTCTTG |
ZFTRAF1: Zinc finger TRAF-type containing 1, IL: Interleukin, TGF: Transforming growth factor, TNF: Tumor necrosis factor, Arg: Arginase, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, A: Adenine, C: Cytosine, G: Guanine, T: Thymine
Histology examination and immunohistochemistry
The tumors were paraffin-embedded. Then, the paraffin blocks were cut into 4 µm-thick slices. The tumor tissue was sliced and incubated with E-cadherin (A3044, ABclonal, Wuhan, China) and N-cadherin (A0433, ABclonal, Wuhan, China). The antibody dilution ratio was 1:200. Diaminobenzidine (P0203, Beyotime Biotechnology, Shanghai, China) was detected as a positive secondary antibody and analyzed with a Japan Olympus BX46 microscope.
Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining
Tumor section apoptosis was detected using a TUNEL Assay Kit (BL646, Biosharp, Hubei, China). A total of 20 µL/mL protease K was incubated for 15 min at room temperature and then incubated with the equilibration buffer for 30 min. In the labeling reaction, the TdT labels the exposed 3’-OH end of the DNA fragment with fluorescein-labeled deoxynucleotides. Finally, images were detected by a fluorescence microscope (IX71, Olympus, Tokyo, Japan).
Western Blot
The tissues or cells were lysed with radioimmunoprecipitation assay solution (R0010, Solarbio, Beijing, China). After the addition of the soluble protein to the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) sample loading buffer (BL529B, Biosharp, Hubei, China), the protein was heated to 100°C for 5 min to denature it. Through 15% SDS-PAGE electrophoresis, the denatured proteins were separated and then placed onto polyvinylidene fluoride membranes (IPVH00010, Millipore Corporation, Billerica, MA, USA). The primary antibody (1:1000) was incubated at 4°C for an entire night. Primary antibodies included the following: ZFTRAF1 (PA5-66263), E-cadherin (13-5700), N-cadherin (PA5-19486), MMP9 (PA5-13199), Snail (MA5-14801), inducible nitric oxide synthase (iNOS) (53-5920-82), PI3K (MA1-74183), p-PI3K (PA5-17387), AKT (MA5-14916), p-AKT (44-621G), tubulin (MA5-16308), and β-actin (PA1-183). All primary antibodies were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Then, the secondary antibody (1:10000, #7074, CST, BSN, Ma, USA) was incubated at room temperature for 1 h. Finally, the protein bands were developed using enhanced chemiluminescence (ECL, BL520b, Biosharp Life Science, Hefei, Anhui, China) and a chemiluminescence instrument (Image Quant LAS4000, GE Healthcare, Chicago, IL, USA), and the gray values were analyzed by Image J (v1.8, National Institutes of Health, Bethesda, MD, USA).
Statistical analysis
GraphPad Prism 9.0 software (GraphPad Software, Inc., San Diego, CA, USA) was used to analyze and process experimental data. Data are expressed as mean ± standard deviation. Comparison between the two groups was performed through t-test. One-way analysis of variance and Tukey’s multiple difference test were used to detect the differences between groups. P < 0.05 was considered statistically significant.
RESULTS
Effect of silencing ZFTRAF1 expression on lung adenocarcinoma cells
BEAS-2B refers to a normal epithelial cell of the human lung. Figure 1a shows the expression levels of ZFTRAF1 messenger RNA (mRNA) in BEAS-2B, A549, and HCC827 to explore the differences in the ZFTRAF1 present in normal lung cells and lung adenocarcinoma cells. The expression levels of ZFTRAF1 mRNA in A549 (P < 0.001) and HCC827 (P < 0.01) cells were significantly increased. This finding indicates that the expression level of ZFTRAF1 was high in lung adenocarcinoma cells, and thus, we silenced the expression of ZFTRAF1. Western blot verified that the sh-ZFRAF1 group’s ZFTRAF1 expression level was markedly reduced (P < 0.001) [Figure 1b and c]. As shown in Figure 1d-f, ZFTRAF1 was down-regulated, and the activity was inhibited (P < 0.001). Figure 1g-k reveals that the migration and invasion ability in the sh-ZFTRAF1 group were significantly reduced (P < 0.001).
- Effect of silencing ZFTRAF1 expression. (a) ZFTRAF1 mRNA level. (b and c) ZFTRAF1 protein level. (d) Activity of A549 and HCC827 cells after ZFTRAF1 silencing analyzed. Scale bar= 100 µm. (e and f) Activity of A549 and HCC827 cells after ZFTRAF1 silencing analyzed via CCK-8 assay. (g-i) Transwell assay analysis of the migration and invasion ability of A549 and HCC827 cells after silencing of ZFTRAF1. Scale bar= 50 µm. (j and k) Migration ability of A549 and HCC827 cells after the analysis of ZFTRAF1 silencing via wound-healing assay. Scale bar= 100 µm. n=3. ns, no statistical significance; ✶✶P<0.01, ✶✶✶P<0.001. NC: Negative control, ZFTRAF1: Zinc finger TRAF-type containing 1, sh-NC: Negative control lentiviruses, sh-ZFTRAF1: ZFTRAF1-interfering lentiviruses.
Effect of silencing ZFTRAF1 expression on the EMT process and PI3K-AKT in lung adenocarcinoma cells
Figure 2a-e demonstrates the considerable decreases in N-cadherin, MMP9, and Snail expression levels in the shZFTRAF1 group (P < 0.001). In addition, the expression levels of E-cadherin increased significantly. Figure 2f-h shows that down-regulation of ZFTRAF1 expression inhibited the p-PI3K and p-AKT (P < 0.01). These results suggest that ZFTRAF1 promotes the EMT process and PI3K-AKT signaling pathway in lung adenocarcinoma.
- Effect of silencing ZFTRAF1 expression on the epithelial-mesenchymal transformation process and PI3K-AKT pathway. (a-e) E-cadherin, N-cadherin, MMP9, and Snail protein levels in A549 and HCC827 cells. (f-h) Phosphorylation levels of PI3K and AKT in A549 and HCC827 cells. n=3. ✶✶p<0.01, ✶✶✶P<0.001. MMP-9: Matrix metallopeptidase 9; PI3K, p: Phosph; phosphoinositide 3-kinase, AKT: Protein kinase B.
Effect of silencing ZFTRAF1 expression on co-culture of lung adenocarcinoma cells and macrophages
First, we determined the expression of M1/M2 markers in macrophages after co-culture with lung adenocarcinoma cells. Figure 3a shows the morphology of macrophages, where THP-1 cells changed from suspension to adherent growth, stopped proliferating, and became irregular in shape. The iNOS expression level in the sh-ZFTRAF1 group was considerably greater (P < 0.001) [Figure 3b and c]. In addition, the cell proportion of M1 markers CD86+ and CD64+ (P < 0.001) and the mRNA expression levels of interleukin (IL)-1α, IL-1β, IL-6, and tumor necrosis factor-α increased significantly (P < 0.001). On the other hand, a large decrease in the cell fraction of the M2 marker CD163+ and significant decreases in the Arg-1, IL-10, IL-13, and transforming growth factor-β mRNA expression levels (P < 0.001) [Figure 3d-h] were observed. These findings indicate that down-regulated ZFTRAF1 expression inhibited macrophage M2 polarization.
- Effect of silencing ZFTRAF1 expression on co-culture of lung adenocarcinoma cells and macrophages. (a) Cell morphology of macrophages. Scale bar = 100 µm. (b and c) INOS protein level in co-cultured THP-1 cells. (d-f) Proportions of CD64+, CD86+, and CD163+ macrophages in co-cultured THP-1 cells determined via flow cytometry. (g and h) The mRNA levels of the M1 or M2 macrophage markers in the co-cultured THP-1 cells. n=3. ✶✶✶P<0.001. INOS: Inducible nitric oxide synthase.
Effect of overexpression of ZFTRAF1 on lung adenocarcinoma cells
We further verified the effect of ZFTRAF1 on lung adenocarcinoma by upregulating its expression level. First, the ZFTRAF1 expression level was considerably higher in the OE-ZFTRAF1 group [Figure 4a and b] (P < 0.001). Figure 4c-e shows that after ZFTRAF1 overexpression, the cell viability increased (P < 0.001). Figure 4f-j reveals that the overexpression of ZFTRAF1 enhanced the ability for cell migration and invasion (P < 0.01). In summary, ZFTRAF1 overexpression improved lung adenocarcinoma cell viability and invasion.
- Effect of overexpression of ZFTRAF1. (a and b) Expression of ZFTRAF1 protein. (c) Activity analyzed by Trypan blue exclusion assay. Scale bar = 100 µm. (d and e) Activity of A549 and HCC827 cells. (f-h) A549 and HCC827 cells’ capacity for invasion and migration examined using the Transwell test. Scale bar = 50 µm. (i and j) Migration ability of A549 and HCC827 cells analyzed in wound-healing assay. Scale bar = 100 µm. n=3. ns: No statistical significance; ✶✶P<0.01, ✶✶✶P<0.001. OE-NC: Negative controls to ZFTRAF1-overexpressing lentiviruses; OE-ZFTRAF1, ZFTRAF1-overexpressing lentiviruses.
Effect of overexpression ZFTRAF1 on the EMT process and PI3K-AKT signaling pathway
As displayed in Figure 5a-e, ZFTRAF1 overexpression increased N-cadherin, MMP9, and Snail expression levels while decreasing that of E-cadherin (P < 0.001). In addition, overexpression of ZFTRAF1 promoted the level of p-PI3K and p-AKT (P < 0.001) [Figures 5f-h]. These results suggest that ZFTRAF1 promotes the EMT processes and activates the PI3K-AKT signaling pathway.
- Effect of overexpression Zinc finger TRAF-type containing 1 expression on epithelialmesenchymal transformation process and PI3K-AKT signaling pathway in lung adenocarcinoma cells. (a-e) E-cadherin, N-cadherin, MMP9, and snail protein levels. (f-h) Phosphorylation levels of PI3K and AKT. n=3. ✶✶✶P<0.001.
Effect of overexpression of ZFTRAF1 combined with LY294002 on lung adenocarcinoma cells
LY294002 is the self of PI3K-AKT signaling pathway. We further demonstrated the association between ZFTRAF1, PI3K-AKT signaling, and lung adenocarcinoma by upregulating ZFTRAF1 expression in combination with LY294002. Figure 6a and b show that the expression of ZFTRAF1 was not statistically significant between OE-ZFTRAF1 and OEZFTRAF1+LY294002 groups. As shown in Figure 6c and d, the viability decreased significantly after the combination with LY294002 (P < 0.001). Furthermore, the migratory and invading capacities were significantly decreased in the OE-ZFTRAF1+LY294002 group (P < 0.001) [Figure 6e-i]. Finally, the EMT process and protein expression in PI3K-AKT signaling after the intervention of LY294002 [Figure 6j-n]. The findings demonstrate that following LY294002 intervention, N-cadherin, MMP9, and Snail expression levels were all dramatically down-regulated, whereas E-cadherin expression was significantly up-regulated (P < 0.001). As shown in Figure 6o-q, the levels of p-PI3K and p-AKT were significantly decreased in the OE-ZFTRAF1+LY294002 group (P < 0.001). In conclusion, lung adenocarcinoma cells’ ability to migrate, invade, and retain viability can still be inhibited by blocking the essential proteins’ expressions in the downstream PI3K-AKT signaling after ZFTRAF1 expression has been upregulated. This outcome also inhibits the EMT process.
- Effect of overexpression of Zinc finger TRAF-type containing 1 (ZFTRAF1) combined with LY294002 on lung adenocarcinoma cells. (a and b) Expression of ZFTRAF1 protein in A549 and HCC827 cells. (c and d) Activity of A549 and HCC827 cells. (e-g) The migration and invasion abilities of A549 and HCC827 cells. Scale bar = 50 µm. (h and i) Migration abilities of A549 and HCC827 cells. Scale bar = 100 µm. (j-n) E-cadherin, N-cadherin, MMP9, and Snail protein levels in A549 and HCC827 cells. (o-q) The levels of p-PI3K and p-AKT in A549 and HCC827 cells. n=3. ns, no statistical significance; ✶✶✶P<0.001.
Effect of silencing ZFTRAF1 expression in vivo on lung adenocarcinoma
We injected A549 and HCC827 cells into mice to establish xenograft lung adenocarcinoma tumor models. The KD group’s tumor weight and volume were significantly lower [Figure 7a-e] (P < 0.001). Figure 7f shows that the tumor cells in the Control group were large in volume and uneven in distribution. The tumor cells in the KD group were smaller, and the cell space was enlarged. Figure 7g-i demonstrates that the KD group’s A549 and HCC827 cell apoptosis counts were significantly higher (P < 0.001). In addition, the number of E-cadherin-positive cells grew dramatically in the KD group, whereas the proportion of N-cadherin-positive cells significantly decreased according to immunohistochemistry results [Figure 7j-l] (P < 0.001). Figure 7m-o reveals a significant drop in the phosphorylation levels of AKT and PI3K when comparing the KD group (P < 0.001).
- Effect of silencing Zinc finger TRAF-type containing 1 expression in vivo on lung adenocarcinoma. (a) Xenograft tumor representation. (b and c) Tumor volume. (d and e) Tumor weight. (f) Hematoxylin and eosin staining representation of xenograft tumor. Scale bar = 50 or 100 µm. (g-i) Xenograft tumors analyzed via transferase dUTP nick end labeling staining. Scale bar = 150 µm. (j-l) Levels of E-cadherin and N-cadherin in xenograft tumors analyzed by immunohistochemical staining. Scale bar = 150 µm. (m-o) The levels of phosphoinositide 3-kinase and p-AKT in xenograft tumors. n=5. ✶✶✶P<0.001.
DISCUSSION
People have become more conscious about their health and started naming detect diseases through early screening and seek cures. Thus, the main objective of continuing research has been to identify possible targets for the treatment of lung adenocarcinoma. In vitro, our results unveil that down-regulating the expression of ZFTRAF1 inhibits the activity of lung adenocarcinoma cells and reduces the migration and invasion abilities of lung adenocarcinoma cells. Abnormal differentiation and proliferation of tumor cells, enhanced migration, and invasion, abilities are the basic characteristics of malignant tumors.[16] When tumor cells invade, they may threaten a patient’s life.[17] Therefore, cell viability, migration, and proliferation capacity are important indicators for the evaluation of tumorigenesis.
Macrophages can undergo polarization, which results in two distinct phenotypes (M1 or M2 macrophages). M2-type macrophages facilitate the proliferation of tumors and their spread to other parts of the body.[18] In the tumor environment, especially in the advanced stage of the tumor, macrophages are mainly type M2.[19] Therefore, we co-cultured lung adenocellular cells and THP-1 cells, and the results revealed that down-regulated ZFTRAF1 expression inhibited M2 polarization and promoted M1 polarization in macrophages. Rao et al.[20] and Chen et al.[21] reported that M2 macrophages promote the progression and metastasis of lung adenocarcinoma tumors and are associated with poor prognosis of patients. These findings are consistent with ours and further prove that macrophages are critical for the spread of tumor cells. In addition, ZFTRAF1 can regulate macrophage differentiation and promote the progression of lung adenocarcinoma.
During EMT, tumor cells lose intercellular adhesion and acquire mesenchymal characteristics with a high invasive ability.[22,23] In vitro and in vivo results unveiled that down-regulating the expression level of ZFTRAF1 inhibited the EMT process, and its overexpression promoted the EMT process, which indicates that the inhibition of ZFTRAF1 to reach the target level alleviated the occurrence and migration of lung adenocarcinoma through the EMT process. Furthermore, a strong correlation exists between the PI3KAKT signaling pathway and the development of non-small cell cancer.[24,25] The PI3K-AKT signaling system governs the movement, growth, cellular metabolism, and EMT of lung cancer.[26] Our experimental results show the same finding. When ZFTRAF1 expression was silenced in in vivo and in vitro trials, decrease phosphorylation of important proteins in the PI3K-AKT signaling pathway was observed. We also combined the PI3K-AKT signaling pathway with the inhibitor LY29402 to further demonstrate that PI3K and AKT are key downstream proteins in the treatment of lung adenocarcinoma. In the Singh et al.[27] report, SF1126 is a novel LY294002 conjugated prodrug that exerts anti-tumor effects by blocking the PI3K pathway. In addition, there is growing evidence that PI3K blocking helps improve tumor susceptibility to immunotherapy.[27] Therefore, the follow-up clinical targeting study of ZFTRAF1 can refer to the method of Singh et al.,[27] and human phase I and II clinical trials can be conducted to provide new targeted drugs for the treatment of lung adenocarcinoma.
However, in this work, we only discussed PI3K-AKT as a possible downstream pathway. In other studies, mammalian target of rapamycin and nuclear factor-κB signaling were targeted pathways for lung adenocarcinoma therapy.[28,29]
Furthermore, the study’s sample size was insufficient, and the tumor tissues of patients who had lung adenocarcinoma were not employed. From the standpoint of animal research, ZFTRAF1 may be a potential target for the therapy of lung adenocarcinoma. Subsequent studies should expand the type and number of experimental samples, such as genetically engineered mouse models or patient-derived xenografts, to verify our conjecture and current experimental results and thereby promoted the development of new treatment strategies for lung adenocarcinoma to improve the survival rate of lung adenocarcinoma patients and provide a new perspective for clinical treatment targets.
SUMMARY
This study demonstrated that ZFTRAF1 may be a target for the treatment of lung adenocarcinoma. Suppressing the expression of ZFTRAF1 hindered the functioning of lung adenocarcinoma cells and reduced their capacity to migrate and invade. In addition, the down-regulation of ZFTRAF1 expression inhibited macrophage M2 polarization, EMT process, and phosphorylation of key proteins of PI3K-AKT. These findings indicate that ZFTRAF1 enhances the progression and spread of lung adenocarcinoma by controlling the processes of EMT and the PI3K-AKT signaling pathway in lung adenocarcinoma cells and influencing the polarization of macrophages.
AVAILABILITY OF DATA AND MATERIALS
The datasets used and analyzed during the current study were available from the corresponding author on reasonable request.
ABBREVIATIONS
AKT: Protein kinase B
Arg: Arginase
CYHR1: Cysteine and histidine-rich 1 protein
DMEM: Dulbecco’s modified eagle medium
EMT: Epithelial–mesenchymal transition
FBS: Fetal bovine serum
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
H&E: Hematoxylin and eosin
IL: Interleukin
PBS: Phosphate buffer saline
PMSF: Phenylmethanesulfonyl fluoride
PVDF: Polyvinylidene fluoride
qRT-PCR: Quantitative real-time polymerase chain reaction
RIPA: Radioimmunoprecipitation assay
SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis
TGF: Transforming growth factor
TNF: Tumor necrosis factor
ZFTRAF1: Zinc finger TRAF-type containing 1
AUTHOR CONTRIBUTIONS
YY and QZ: Designed the study, all authors conducted the study; YY and LS: Collected and analyzed the data; YY and LS: Participated in drafting the manuscript, and all authors contributed to critical revision of the manuscript for important intellectual content. All authors participated fully in the work, took public responsibility for appropriate portions of the content, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or completeness of any part of the work were appropriately investigated and resolved. All authors gave final approval of the version to be published. All authors meet ICMJE authorship requirements.
ACKNOWLEDGMENT
Not applicable.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All mice were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd (SCXK(Jing) 2016-0006). All animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Shandong Provincial Hospital Affiliated to Shandong First Medical University. The study was approved by the Institutional Animal Care and Use Committee of Shandong Provincial Hospital Affiliated to Shandong First Medical University (HSRF2022-0013).
CONFLICTS OF INTEREST
The authors declare no conflicts of interest.
EDITORIAL/PEER REVIEW
To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.
FUNDING: Not applicable.
References
- Lung squamous cell carcinoma and lung adenocarcinoma differential gene expression regulation through pathways of notch, hedgehog, wnt, and erbb signalling. Sci Rep. 2020;10:21128.
- [CrossRef] [PubMed] [Google Scholar]
- The global burden of lung cancer: Current status and future trends. Nat Rev Clin Oncol. 2023;20:624-39.
- [CrossRef] [PubMed] [Google Scholar]
- Interaction of a novel cysteine and histidine-rich cytoplasmic protein with galectin-3 in a carbohydrate-independent manner. FEBS Lett. 2000;470:227-31.
- [CrossRef] [PubMed] [Google Scholar]
- Specificity of interactions of galectin-3 with Chrp, a cysteine-and histidine-rich cytoplasmic protein. Biochimie. 2003;85:189-94.
- [CrossRef] [PubMed] [Google Scholar]
- Biallelic loss-of-function variants of ZFTRAF1 cause neurodevelopmental disorder with microcephaly and hypotonia. Genet Med. 2024;26:101143.
- [CrossRef] [PubMed] [Google Scholar]
- Discovery and validation of combined biomarkers for the diagnosis of esophageal intraepithelial neoplasia and esophageal squamous cell carcinoma. J Proteomics. 2024;304:105233.
- [CrossRef] [PubMed] [Google Scholar]
- The role of PI3K/AKT/mTOR signaling in hepatocellular carcinoma metabolism. Int J Mol Sci. 2023;24:2652.
- [CrossRef] [PubMed] [Google Scholar]
- Curcumin and plumbagin synergistically target the PI3K/Akt/mTOR pathway: A prospective role in cancer treatment. Int J Mol Sci. 2023;24:6651.
- [CrossRef] [PubMed] [Google Scholar]
- Targeting the PI3K signaling pathway in cancer therapy. Expert Opin Ther Targets. 2012;16:121-30.
- [CrossRef] [PubMed] [Google Scholar]
- Natural products targeting the PI3K-Akt-mTOR signaling pathway in cancer: A novel therapeutic strategy. Semin Cancer Biol. 2022;80:1-17.
- [CrossRef] [PubMed] [Google Scholar]
- Targeting the PI3K/Akt/mTOR pathway in non-small cell lung cancer (NSCLC) Thorac Cancer. 2020;11:511-18.
- [CrossRef] [PubMed] [Google Scholar]
- Mex3a interacts with LAMA2 to promote lung adenocarcinoma metastasis via PI3K/AKT pathway. Cell Death Dis. 2020;11:614.
- [CrossRef] [PubMed] [Google Scholar]
- Inhibition of PI3K/Akt/mTOR signaling pathway alleviates ovarian cancer chemoresistance through reversing epithelialmesenchymal transition and decreasing cancer stem cell marker expression. BMC Cancer. 2019;19:618.
- [CrossRef] [PubMed] [Google Scholar]
- PCSK9 promotes the progression and metastasis of colon cancer cells through regulation of EMT and PI3K/AKT signaling in tumor cells and phenotypic polarization of macrophages. J Exp Clin Cancer Res. 2022;41:303.
- [CrossRef] [PubMed] [Google Scholar]
- Long non-coding RNA AFAP1-AS1 accelerates lung cancer cells migration and invasion by interacting with SNIP1 to upregulate c-Myc. Signal Transduct Target Ther. 2021;6:240.
- [CrossRef] [PubMed] [Google Scholar]
- Cancer invasion and the microenvironment: Plasticity and reciprocity. Cell. 2011;147:992-1009.
- [CrossRef] [PubMed] [Google Scholar]
- Linc00514 promotes breast cancer metastasis and M2 polarization of tumor-associated macrophages via Jagged1-mediated notch signaling pathway. J Exp Clin Cancer Res. 2020;39:191.
- [CrossRef] [PubMed] [Google Scholar]
- Tumor cell-derived exosomal miR-770 inhibits M2 macrophage polarization via targeting MAP3K1 to inhibit the invasion of non-small cell lung cancer cells. Front Cell Dev Biol. 2021;9:679658.
- [CrossRef] [PubMed] [Google Scholar]
- NLRP6 is required for cancer-derived exosome-modified macrophage M2 polarization and promotes metastasis in small cell lung cancer. Cell Death Dis. 2022;13:891.
- [CrossRef] [PubMed] [Google Scholar]
- Tumor-derived exosomal circFARSA mediates M2 macrophage polarization via the PTEN/PI3K/AKT pathway to promote non-small cell lung cancer metastasis. Cancer Treat Res Commun. 2021;28:100412.
- [CrossRef] [PubMed] [Google Scholar]
- Epithelialmesenchymal transitions in development and disease. Cell. 2009;139:871-90.
- [CrossRef] [PubMed] [Google Scholar]
- Long non-coding RNAs as the critical regulators of epithelial mesenchymal transition in colorectal tumor cells: An overview. Cancer Cell Int. 2022;22:71.
- [CrossRef] [PubMed] [Google Scholar]
- Antitumor activity of curcumin by modulation of apoptosis and autophagy in human lung cancer A549 cells through inhibiting PI3K/Akt/mTOR pathway. Oncol Rep. 2018;39:1523-31.
- [CrossRef] [PubMed] [Google Scholar]
- Prominin 2 knockdown inhibits the growth, migration, and invasion of non-small cell lung cancer cells by repressing phosphatidylinositol 3 kinase/protein kinase B pathway. Cytojournal. 2025;22:21.
- [CrossRef] [PubMed] [Google Scholar]
- PI3K/AKT pathway as a pivotal regulator of epithelial-mesenchymal transition in lung tumor cells. Cancer Cell Int. 2024;24:165.
- [CrossRef] [PubMed] [Google Scholar]
- Single agent and synergistic activity of the “First-in-Class” dual PI3K/BRD4 inhibitor SF1126 with sorafenib in hepatocellular carcinoma. Mol Cancer Ther. 2016;15:2553-62.
- [CrossRef] [PubMed] [Google Scholar]
- Effect of miR-21 on apoptosis in lung cancer cell through inhibiting the PI3K/Akt/NF-κB signaling pathway in vitro and in vivo. Cell Physiol Biochem. 2018;46:999-1008.
- [CrossRef] [PubMed] [Google Scholar]
- Targeting PI3K/AKT/mTOR pathway in non small cell lung cancer. Biochem Pharmacol. 2014;90:197-207.
- [CrossRef] [PubMed] [Google Scholar]